ID: 912601013

View in Genome Browser
Species Human (GRCh38)
Location 1:110933545-110933567
Sequence AGGGAGAGCACAGCAATTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912601002_912601013 28 Left 912601002 1:110933494-110933516 CCAGGTGGTGTAGAGGCCAGGTT No data
Right 912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG No data
912601006_912601013 12 Left 912601006 1:110933510-110933532 CCAGGTTGTGTGGAGGGCATCTC No data
Right 912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912601013 Original CRISPR AGGGAGAGCACAGCAATTGC GGG Intergenic
No off target data available for this crispr