ID: 912604211

View in Genome Browser
Species Human (GRCh38)
Location 1:110971859-110971881
Sequence CATAACTCCCACTTAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912604211_912604219 29 Left 912604211 1:110971859-110971881 CCCACTTTTAAGTGGGAGTTATG No data
Right 912604219 1:110971911-110971933 CAGACACGAGGCCTATTGTAGGG No data
912604211_912604218 28 Left 912604211 1:110971859-110971881 CCCACTTTTAAGTGGGAGTTATG No data
Right 912604218 1:110971910-110971932 ACAGACACGAGGCCTATTGTAGG No data
912604211_912604213 -9 Left 912604211 1:110971859-110971881 CCCACTTTTAAGTGGGAGTTATG No data
Right 912604213 1:110971873-110971895 GGAGTTATGATGAGAACACATGG No data
912604211_912604217 17 Left 912604211 1:110971859-110971881 CCCACTTTTAAGTGGGAGTTATG No data
Right 912604217 1:110971899-110971921 CATAGAGAACAACAGACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912604211 Original CRISPR CATAACTCCCACTTAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr