ID: 912604266

View in Genome Browser
Species Human (GRCh38)
Location 1:110972319-110972341
Sequence GAAAGAAATAAGAGATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912604266_912604269 20 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604269 1:110972362-110972384 GTTCTCTTCCTTACACAGGCTGG No data
912604266_912604273 28 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604273 1:110972370-110972392 CCTTACACAGGCTGGGTGGTAGG No data
912604266_912604268 16 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604268 1:110972358-110972380 TTTTGTTCTCTTCCTTACACAGG No data
912604266_912604270 21 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604270 1:110972363-110972385 TTCTCTTCCTTACACAGGCTGGG No data
912604266_912604271 24 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912604266 Original CRISPR GAAAGAAATAAGAGATAAAA TGG (reversed) Intergenic
No off target data available for this crispr