ID: 912604267

View in Genome Browser
Species Human (GRCh38)
Location 1:110972343-110972365
Sequence GAACAAAAGAGAGATAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912604267_912604278 25 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604278 1:110972391-110972413 GGTGTGGGAGCTGGGTGCAGTGG No data
912604267_912604275 10 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604275 1:110972376-110972398 ACAGGCTGGGTGGTAGGTGTGGG No data
912604267_912604270 -3 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604270 1:110972363-110972385 TTCTCTTCCTTACACAGGCTGGG No data
912604267_912604268 -8 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604268 1:110972358-110972380 TTTTGTTCTCTTCCTTACACAGG No data
912604267_912604274 9 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604274 1:110972375-110972397 CACAGGCTGGGTGGTAGGTGTGG No data
912604267_912604271 0 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG No data
912604267_912604277 17 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604277 1:110972383-110972405 GGGTGGTAGGTGTGGGAGCTGGG No data
912604267_912604276 16 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604276 1:110972382-110972404 TGGGTGGTAGGTGTGGGAGCTGG No data
912604267_912604273 4 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604273 1:110972370-110972392 CCTTACACAGGCTGGGTGGTAGG No data
912604267_912604269 -4 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604269 1:110972362-110972384 GTTCTCTTCCTTACACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912604267 Original CRISPR GAACAAAAGAGAGATAGAAA AGG (reversed) Intergenic
No off target data available for this crispr