ID: 912604271

View in Genome Browser
Species Human (GRCh38)
Location 1:110972366-110972388
Sequence TCTTCCTTACACAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912604266_912604271 24 Left 912604266 1:110972319-110972341 CCATTTTATCTCTTATTTCTTTC No data
Right 912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG No data
912604267_912604271 0 Left 912604267 1:110972343-110972365 CCTTTTCTATCTCTCTTTTGTTC No data
Right 912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912604271 Original CRISPR TCTTCCTTACACAGGCTGGG TGG Intergenic
No off target data available for this crispr