ID: 912606416

View in Genome Browser
Species Human (GRCh38)
Location 1:110994106-110994128
Sequence TGCTGGCTCTACTTTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912606416_912606422 -7 Left 912606416 1:110994106-110994128 CCCAAATCAAAGTAGAGCCAGCA No data
Right 912606422 1:110994122-110994144 GCCAGCAGATCATAAGGGAGGGG No data
912606416_912606420 -9 Left 912606416 1:110994106-110994128 CCCAAATCAAAGTAGAGCCAGCA No data
Right 912606420 1:110994120-110994142 GAGCCAGCAGATCATAAGGGAGG No data
912606416_912606421 -8 Left 912606416 1:110994106-110994128 CCCAAATCAAAGTAGAGCCAGCA No data
Right 912606421 1:110994121-110994143 AGCCAGCAGATCATAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912606416 Original CRISPR TGCTGGCTCTACTTTGATTT GGG (reversed) Intergenic
No off target data available for this crispr