ID: 912606420

View in Genome Browser
Species Human (GRCh38)
Location 1:110994120-110994142
Sequence GAGCCAGCAGATCATAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912606416_912606420 -9 Left 912606416 1:110994106-110994128 CCCAAATCAAAGTAGAGCCAGCA No data
Right 912606420 1:110994120-110994142 GAGCCAGCAGATCATAAGGGAGG No data
912606417_912606420 -10 Left 912606417 1:110994107-110994129 CCAAATCAAAGTAGAGCCAGCAG No data
Right 912606420 1:110994120-110994142 GAGCCAGCAGATCATAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912606420 Original CRISPR GAGCCAGCAGATCATAAGGG AGG Intergenic
No off target data available for this crispr