ID: 912608639

View in Genome Browser
Species Human (GRCh38)
Location 1:111019440-111019462
Sequence GCATTTGCAGTTGTGTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912608639_912608641 2 Left 912608639 1:111019440-111019462 CCACAGTACACAACTGCAAATGC No data
Right 912608641 1:111019465-111019487 AGATGCACAAAGGAGCCATGTGG No data
912608639_912608640 -8 Left 912608639 1:111019440-111019462 CCACAGTACACAACTGCAAATGC No data
Right 912608640 1:111019455-111019477 GCAAATGCAAAGATGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912608639 Original CRISPR GCATTTGCAGTTGTGTACTG TGG (reversed) Intergenic
No off target data available for this crispr