ID: 912618735

View in Genome Browser
Species Human (GRCh38)
Location 1:111133670-111133692
Sequence CACATCCAGCTCTATGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912618735 Original CRISPR CACATCCAGCTCTATGACCT TGG (reversed) Intronic
901144303 1:7054707-7054729 CACTTCCGGCTCTGTGACCCGGG + Intronic
902191672 1:14767577-14767599 CAAGTCCAGCTCTTTGACCTAGG - Intronic
902340954 1:15783396-15783418 CAGAACCAGCTGTGTGACCTGGG + Intronic
902775678 1:18673140-18673162 CACATATAGCTGTGTGACCTTGG + Intronic
903182460 1:21611831-21611853 GAACTCCAGCTCAATGACCTTGG - Intronic
903462488 1:23529581-23529603 CACATTCAGCTCCAGGTCCTGGG - Intronic
903785470 1:25858599-25858621 CACATTCAGGTCTGTCACCTAGG - Intronic
904329032 1:29745910-29745932 CACAGCCAGCTGTGTGGCCTTGG + Intergenic
904423250 1:30407553-30407575 CACATCCATCTCTATGAAATGGG + Intergenic
904692849 1:32307566-32307588 AACATCCAGCTCTGTCCCCTGGG - Intronic
904902907 1:33871520-33871542 CAGATGCAGCCCTTTGACCTTGG - Intronic
904975714 1:34454722-34454744 CACATACAGTTGTGTGACCTTGG - Intergenic
905243521 1:36596721-36596743 CACATCCAGCTCCAGGACAGTGG + Intergenic
905879598 1:41454923-41454945 CACCTCTAGCTGTGTGACCTTGG + Intergenic
906665535 1:47618977-47618999 CACTTACAGCTTTATGATCTTGG - Intergenic
906696212 1:47825062-47825084 CACAGCCCGCTCTGTGACCTTGG - Intronic
906726707 1:48049551-48049573 CACCTCCAGCTGTGTGACTTTGG + Intergenic
907405972 1:54253736-54253758 CCCATCCACCTCCATGTCCTGGG - Intronic
908329113 1:63052889-63052911 CACTTCCAGCTGTGTGACCTTGG - Intergenic
910682113 1:89877290-89877312 CACTTACAGCTTTTTGACCTTGG + Intronic
910827071 1:91420439-91420461 AACATATAGCTTTATGACCTGGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912565872 1:110586940-110586962 CACTTCCAGCTATGTGTCCTTGG + Intergenic
912618735 1:111133670-111133692 CACATCCAGCTCTATGACCTTGG - Intronic
914395687 1:147265532-147265554 CACATCCAGCTGTGTGACTTTGG + Intronic
914691399 1:150031700-150031722 ACCTTCCAGCTCTTTGACCTTGG + Intergenic
915354361 1:155247326-155247348 CACCTCTAGCTGCATGACCTTGG - Exonic
915532629 1:156511822-156511844 CATTTCCAGCTGTGTGACCTTGG + Intergenic
917092423 1:171366786-171366808 CACATTCACCTCTATGAATTGGG + Intergenic
918448208 1:184635003-184635025 CACTTCCTGCTGTGTGACCTTGG - Intergenic
920744453 1:208613439-208613461 CCCATGCAGCTCTATGGGCTTGG - Intergenic
920842771 1:209568692-209568714 CTCTTATAGCTCTATGACCTGGG - Intergenic
921685139 1:218081476-218081498 GACATCCATCTATATGAGCTTGG + Intergenic
923374579 1:233347842-233347864 CACATGCAGGTGTATTACCTGGG - Intronic
923649010 1:235854548-235854570 CATCTGCTGCTCTATGACCTTGG + Intronic
1064692391 10:17931375-17931397 CACATCAAGATTCATGACCTAGG + Intergenic
1064836619 10:19539279-19539301 CCTGCCCAGCTCTATGACCTTGG - Intronic
1065098514 10:22307590-22307612 TGCTTCCAGTTCTATGACCTTGG - Intergenic
1067316632 10:45172530-45172552 CACATCCATAGCTGTGACCTTGG - Intergenic
1067726452 10:48774645-48774667 CACATCCGGTTCAATGGCCTGGG - Exonic
1069626649 10:69872095-69872117 CTCAACCAGCTGTGTGACCTTGG - Intronic
1069690476 10:70348546-70348568 CACTTCTAGCTATATGACCTGGG - Intronic
1070012095 10:72485591-72485613 GAATTCCAGCTCTATGACCCTGG - Intronic
1072274105 10:93805580-93805602 CTCCTCTAGCTCTAGGACCTGGG + Intergenic
1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG + Intronic
1073344326 10:102770956-102770978 CACAGCCAGCTGTGTGACCTTGG + Intronic
1073434332 10:103507115-103507137 CCAATCCAGCTGTATGACCTTGG - Intronic
1074273347 10:111976687-111976709 ACCATCTAGCTGTATGACCTTGG + Intergenic
1074425288 10:113345474-113345496 CACAGTCATCTCTATTACCTGGG + Intergenic
1074853910 10:117459411-117459433 CCCAGCCAGCTCTTTGAACTTGG - Intergenic
1074942051 10:118245664-118245686 GAAACCCAGCTCTGTGACCTAGG + Intergenic
1074958588 10:118417666-118417688 CCTTTCCAGCTGTATGACCTTGG + Intergenic
1075588794 10:123676779-123676801 CACATCCTGCTGTGTGACTTTGG + Intronic
1075970470 10:126647863-126647885 CACATCCAGCTAGGTGACCTTGG - Intronic
1076246572 10:128951421-128951443 ACCAGCCAGCTCTTTGACCTGGG + Intergenic
1078423799 11:11233472-11233494 CAGATCCAGCTCGATGACCTGGG + Intergenic
1078465008 11:11543682-11543704 CCCATCCATCCCTAGGACCTAGG + Intronic
1078525779 11:12100198-12100220 CAAATCTAGCTGTATGACCTTGG - Intronic
1079033587 11:17003624-17003646 CACATACAGCTCCCTGACCTTGG - Intronic
1079519826 11:21313627-21313649 CAGATGCAGCCCTTTGACCTTGG - Intronic
1080694263 11:34587460-34587482 TCCTTCCAGCTCTGTGACCTGGG - Intergenic
1080785335 11:35470213-35470235 CAGATCAAGCTATGTGACCTTGG - Intronic
1080790672 11:35519919-35519941 GATATCCAGCTATATGACCTGGG + Intronic
1080876398 11:36278823-36278845 CAGATGCAGCTCCCTGACCTAGG + Intronic
1081740350 11:45435263-45435285 CACTCCCAGCTGTGTGACCTTGG - Intergenic
1084323748 11:68387525-68387547 CACATCCTGCTGTGTGACCCTGG - Intronic
1084463571 11:69309368-69309390 TACATGCAGCTCAGTGACCTGGG + Intronic
1087256647 11:95963452-95963474 CACATCCAGCTCCTTGACACTGG - Intergenic
1087981994 11:104626684-104626706 GGCAACCAGCTGTATGACCTTGG + Intergenic
1089380486 11:118027436-118027458 CATATACAGCTCTGTGAACTGGG - Intergenic
1090211575 11:124924387-124924409 CACTTCTAGCTGTGTGACCTTGG + Intronic
1090778624 11:129986747-129986769 CAGCTCCAGCTCCATGACCCAGG + Intronic
1090962704 11:131571445-131571467 CATTTCCAGTTCTATGACCTTGG - Intronic
1091202027 11:133788335-133788357 CAATTAAAGCTCTATGACCTTGG - Intergenic
1095204392 12:39422935-39422957 CACTTCCAACTCTGTGACCAAGG + Intronic
1095702109 12:45201165-45201187 CACATCCACCTCTCTGCCTTGGG - Intergenic
1096231958 12:49901771-49901793 CACATGCAGCTCTGTGACCTTGG - Intronic
1096374713 12:51099051-51099073 CACTTGCAGCTGTGTGACCTAGG + Intronic
1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG + Intergenic
1097529671 12:60782251-60782273 CAGATGCAGCCCTTTGACCTTGG + Intergenic
1098122581 12:67257332-67257354 CACATCCAACTCTGTCACCTGGG + Intergenic
1102523609 12:113494880-113494902 CACTCCTAGCTCTGTGACCTTGG - Intergenic
1102868449 12:116393244-116393266 CTCATCTGGCTGTATGACCTTGG + Intergenic
1106001606 13:25728703-25728725 CACAGACAGCCCTGTGACCTGGG - Intronic
1106062500 13:26308413-26308435 CCCAGCTAGCTCTGTGACCTTGG + Intronic
1106232798 13:27834302-27834324 CACTTACAGCTGTGTGACCTTGG + Intergenic
1106665348 13:31846171-31846193 TGTAACCAGCTCTATGACCTTGG + Intergenic
1106695857 13:32171876-32171898 CACATCCAGCTCTAAGTCCCTGG - Intronic
1106994087 13:35460866-35460888 CACATGCAGCCCTTTGACCTTGG - Intronic
1107613104 13:42136011-42136033 TACATCCAGTTATGTGACCTTGG + Intronic
1112585780 13:100717191-100717213 CACACCCAGCTCTGTGACACTGG - Intergenic
1114258648 14:21022561-21022583 CACTCCCAGCTCCCTGACCTTGG - Intronic
1116065573 14:39978325-39978347 GCCATCCAACTATATGACCTTGG - Intergenic
1116522020 14:45860916-45860938 CACTTCCACCTCAATCACCTGGG - Intergenic
1116991366 14:51280380-51280402 CACATCTAGCTCTATGATCTTGG - Intergenic
1119730971 14:76950958-76950980 CACTTCCTGCTCTATGGCCCTGG - Intergenic
1120942773 14:89964922-89964944 CATTACCAGCTCTACGACCTTGG - Intronic
1122120266 14:99549507-99549529 CCCAACCTGCTCTGTGACCTTGG + Intronic
1122347453 14:101069388-101069410 CACCTCCAGCTGGGTGACCTTGG - Intergenic
1122468994 14:101953358-101953380 CACTCCCAGCTGCATGACCTTGG - Intergenic
1124721977 15:32118238-32118260 CAGATGCAGCTCCTTGACCTCGG + Intronic
1125762648 15:42107598-42107620 CACAGTCAGCTCTTTGAACTTGG - Intergenic
1126383653 15:48072727-48072749 GACTCCCAGCTCTGTGACCTTGG + Intergenic
1127295533 15:57605577-57605599 CACAGGCAGCTCTCTGTCCTTGG - Intronic
1128525170 15:68407415-68407437 CAAGTCCATCTCTCTGACCTCGG + Intronic
1128529664 15:68435823-68435845 CACACCCAGCCCCATGACTTGGG + Intergenic
1128691632 15:69728591-69728613 CACCTCTAGCTGTATGACTTTGG + Intergenic
1129169909 15:73801370-73801392 CACAACCACCTATGTGACCTGGG - Intergenic
1129842114 15:78750317-78750339 CCCTTCCAGATCTGTGACCTTGG - Intergenic
1131003484 15:88956781-88956803 CACTTCCATCTGTGTGACCTTGG - Intergenic
1131073618 15:89481026-89481048 AACAACCAGTTCTATGACCTTGG - Intronic
1131121663 15:89826891-89826913 CACTTCCAACTGTGTGACCTTGG - Intergenic
1133854553 16:9537323-9537345 CTCATCCAGCTGTGTGACCTTGG - Intergenic
1134306890 16:13041129-13041151 CACATCCAGCTCTGAGATGTTGG - Intronic
1134781724 16:16904285-16904307 GACAACCACCTCTATGCCCTAGG - Intergenic
1135051699 16:19198417-19198439 CACTTCCAGCAGTGTGACCTTGG + Intronic
1135121997 16:19774198-19774220 CACTTCCAGCTGTGTGACTTTGG + Intronic
1137938095 16:52655043-52655065 CAGATGCAGCTCTAGGAGCTGGG - Intergenic
1138543787 16:57704706-57704728 CAGCTCCAGCTCCATGACCTTGG - Intronic
1139278803 16:65751927-65751949 CACTACCAGCTCTATGACTATGG - Intergenic
1139347282 16:66312106-66312128 CTCTTCCAGCGATATGACCTAGG - Intergenic
1140032195 16:71347794-71347816 CCCGCCCAGCTCTGTGACCTTGG - Intergenic
1140530897 16:75664910-75664932 CAGATGCAGCCCTTTGACCTTGG + Intronic
1140726198 16:77815067-77815089 CACTTCTATCTCTATAACCTGGG - Intronic
1141624654 16:85254878-85254900 CACCTCCAGCACTGGGACCTGGG - Intergenic
1203138221 16_KI270728v1_random:1743723-1743745 CACAGGCAGCTTTGTGACCTGGG - Intergenic
1143024469 17:3933399-3933421 CACACCGAGACCTATGACCTGGG - Intronic
1144239557 17:13296849-13296871 CAGCTTCAGCTCTGTGACCTTGG - Intergenic
1144620265 17:16814420-16814442 CCCATCCAGCTCAGGGACCTGGG - Intergenic
1144720710 17:17467934-17467956 AACAGCCAGCTCCGTGACCTTGG - Intergenic
1145348554 17:22057474-22057496 CATTTCCAGCTGTGTGACCTTGG - Intergenic
1145957418 17:28864122-28864144 TGCATCCAGCTCTGTGACTTTGG + Intergenic
1146324620 17:31875216-31875238 AAGATCCAGCTCACTGACCTGGG + Exonic
1146479776 17:33195835-33195857 CACAGCCCACTCTATGACCCAGG - Intronic
1146554820 17:33814185-33814207 CACTTCCAGCTGAATGTCCTTGG - Intronic
1146667354 17:34713977-34713999 CATGTCCAGCTCTGTGCCCTTGG + Intergenic
1146724455 17:35146477-35146499 GACACACAGCTATATGACCTTGG - Intergenic
1146847784 17:36195447-36195469 GACATCCTGCTCTCTGTCCTGGG + Intronic
1146922815 17:36724736-36724758 CGCATCCAGCTGTGTGACCTTGG + Intergenic
1148349979 17:46934196-46934218 CACTTCCAGCTGTGTGATCTTGG + Intronic
1148757568 17:49981696-49981718 CAAGTCCAACTCGATGACCTTGG + Intergenic
1148859872 17:50599246-50599268 CCCAACCAGCTGTGTGACCTGGG - Intronic
1149317391 17:55451321-55451343 CACCTCCAGCTGGCTGACCTTGG + Intergenic
1150331150 17:64295344-64295366 CACAATTAGCTGTATGACCTTGG + Intergenic
1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG + Intergenic
1150653371 17:67024181-67024203 CACATCCTTGTCTATCACCTAGG + Intronic
1150702744 17:67461949-67461971 CACAGCCAGCATTACGACCTGGG + Intronic
1151252218 17:72845037-72845059 CACATCCAGCACGACCACCTTGG + Intronic
1152591143 17:81212947-81212969 CACACCCAGCTCCCAGACCTTGG + Intronic
1153324217 18:3801523-3801545 CACTTCTAGCTCTGTGACCTTGG + Intronic
1153376502 18:4386582-4386604 CTGAGCCAGCTCTTTGACCTTGG - Intronic
1153482060 18:5556752-5556774 CCCTCCCAGCTCTCTGACCTTGG + Intronic
1153576533 18:6527459-6527481 CACATACAGGCCTATGACCTGGG + Intronic
1153763618 18:8354651-8354673 CAATTCTAGCTCTATGCCCTTGG - Intronic
1156217608 18:35015840-35015862 CACATGCAGTTTTATTACCTGGG + Intronic
1157057682 18:44250001-44250023 GGCATCCTGCTCTATGAACTTGG + Intergenic
1157183755 18:45520718-45520740 CACATCTAGCTGTGTGACCTAGG + Intronic
1158303224 18:56076075-56076097 CCCATCTAGTTCTATGACGTGGG - Intergenic
1158350367 18:56559036-56559058 CAAAGCTAGCTCTATGACCTTGG + Intergenic
1158426739 18:57347176-57347198 CATCTCCAGCTCTCTGACCTGGG + Intergenic
1160985707 19:1837611-1837633 CACAGCAAGCTCTGAGACCTGGG - Intronic
1162015731 19:7845606-7845628 CTCAACCAGCTGTGTGACCTTGG - Intronic
1163423849 19:17230050-17230072 GACATCCAGATCTCTGGCCTGGG + Intergenic
1165437543 19:35804541-35804563 CACCTCTAGCTGTGTGACCTGGG - Intronic
1168275996 19:55279132-55279154 CATTTCCAGCTGTGTGACCTTGG - Intronic
925076092 2:1016989-1017011 CTCATCCAGCTCTGAGACCCTGG - Intronic
925538148 2:4938264-4938286 CACATACAGCTCTATGGACCCGG + Intergenic
926842051 2:17091772-17091794 CCCACCCAGCTGTGTGACCTTGG - Intergenic
927857221 2:26535276-26535298 CGCTTCCAGCTCTGTCACCTGGG + Intronic
928229362 2:29483138-29483160 CCCAGCAAGCTGTATGACCTGGG + Intronic
928711117 2:34006548-34006570 CACAGCCAGGTCTACAACCTGGG + Intergenic
929314103 2:40456552-40456574 CAGATCCAGCTGTGTGACCTTGG + Intronic
931975412 2:67638609-67638631 CTCATCAAGCTCTGAGACCTAGG - Intergenic
932666177 2:73700749-73700771 AACATCCAGCTCTCTGCCATGGG - Intergenic
935868254 2:107415984-107416006 CACAGCCAGCTGTGTGGCCTGGG + Intergenic
936055677 2:109260351-109260373 CACATGCAGCTCCCTGACCTCGG - Intronic
937152532 2:119695875-119695897 CCCATCCAGCTGTGTGGCCTTGG + Intergenic
937533072 2:122853623-122853645 CACATCCATCTGTATGTGCTTGG + Intergenic
939187628 2:138879319-138879341 CACTACCAGTTCTGTGACCTGGG - Intergenic
942804629 2:179915683-179915705 CACCTCCAGCTGTGTGATCTAGG - Intergenic
944646641 2:201786930-201786952 CAACTCCAGCTTTGTGACCTTGG + Intergenic
947708416 2:232294615-232294637 CACAGCCTGCTCTCTGACCATGG + Intronic
948587276 2:239027307-239027329 CAAACTCAGCTCTGTGACCTGGG - Intergenic
948701936 2:239766059-239766081 CACACCCAGCGCTGTGCCCTGGG + Intronic
1168890743 20:1294158-1294180 CACCTGCAGCTGTGTGACCTTGG + Intronic
1168893560 20:1309123-1309145 CACAACCCCCTCTCTGACCTGGG + Exonic
1170778994 20:19406725-19406747 CACAGCGTGCTCTATGCCCTCGG + Intronic
1171423426 20:25034090-25034112 CACTTCAAGGTTTATGACCTTGG - Intronic
1171518332 20:25757233-25757255 CATTTCCAGCTGTGTGACCTCGG + Intergenic
1171558526 20:26098973-26098995 CATTTCCAGCTGTGTGACCTCGG - Intergenic
1172065613 20:32218068-32218090 AACTTCAAGCTTTATGACCTTGG - Intronic
1172196894 20:33097948-33097970 CACTTCCAGCTACATGACTTTGG + Intronic
1172297457 20:33823317-33823339 CAGATCTAGCTCTGTGACTTGGG + Intronic
1172477410 20:35249171-35249193 CAGCTCCAGCTCTGTGACCTTGG + Intronic
1173456291 20:43204559-43204581 CTCAACCAGCTCTGTGACTTTGG - Intergenic
1173731074 20:45329025-45329047 CACTTCCAGCTTTGTGACTTCGG + Intronic
1174193893 20:48759142-48759164 CACCTACTGCTCTGTGACCTAGG + Intronic
1174980740 20:55391809-55391831 CACAGCCATCTCTCTGCCCTTGG - Intergenic
1175149285 20:56920487-56920509 CACTGGCAGCTCTGTGACCTTGG - Intergenic
1178105803 21:29317913-29317935 CACTACTAGCTATATGACCTTGG - Intronic
1178683930 21:34696529-34696551 CAAATCCTGCTTTGTGACCTTGG + Intronic
1178885656 21:36483043-36483065 CACTTACAGGTGTATGACCTTGG - Intronic
1179068916 21:38053675-38053697 CAGCTCCAGCTCCATGGCCTGGG - Intronic
1180145833 21:45918227-45918249 CCCATGCAGCTCCATGACCGGGG + Intronic
1181987227 22:26808583-26808605 CACTTCTGGCTCTGTGACCTGGG - Intergenic
1182994611 22:34800973-34800995 CATTTCCAGCTCTATGACAGTGG - Intergenic
1183156354 22:36078511-36078533 CACAACTAGCTGTATGCCCTTGG - Intergenic
1183795499 22:40113730-40113752 CCCATCCAGCTCTGTGAGCAGGG - Intronic
1184299714 22:43550249-43550271 CTCATCCAGCTGTGTGACCCTGG - Intronic
1184344690 22:43905971-43905993 CACAGACAGCTCTGTGACCTCGG - Intergenic
949417146 3:3827242-3827264 CAAATTCAGCTCTGTGACCTTGG - Intronic
949506692 3:4735174-4735196 CGGATCCAGCTCTATGAGCAGGG + Exonic
949526460 3:4909507-4909529 CCCATCCAGCTCTAAGAACATGG + Intergenic
949644147 3:6073902-6073924 TACATCCTACTCTAGGACCTAGG + Intergenic
950111271 3:10420304-10420326 TCCTTCCAGCTCTGTGACCTTGG + Intronic
950287590 3:11757135-11757157 CAGATTCAGCTCAGTGACCTGGG - Intergenic
951903206 3:27677794-27677816 CATTTCCAACTCTCTGACCTTGG + Intergenic
952226496 3:31382135-31382157 CACTCCCAACTCTCTGACCTGGG + Intergenic
952810854 3:37401284-37401306 CACATCCTGCTCTATGACCTTGG + Intronic
953005788 3:38978120-38978142 CACCACCAGCTCTGTGATCTTGG - Intergenic
953918011 3:46932962-46932984 CACACCCTGCTCTCTGGCCTAGG + Intronic
954362138 3:50127511-50127533 CACAGCCAGCTCTGTCACGTGGG + Intergenic
954779548 3:53048937-53048959 AACAACCAGCCCTGTGACCTTGG + Intronic
954823085 3:53348027-53348049 CACATCCATATCTGAGACCTAGG - Intergenic
954848640 3:53581712-53581734 TACATCCAGCCCTAGGACCCTGG - Intronic
956287065 3:67621766-67621788 CAGATACAGCCCTTTGACCTTGG + Intronic
956328021 3:68074451-68074473 TATTTCCTGCTCTATGACCTTGG + Intronic
956673017 3:71708975-71708997 CACACCCAGCTCACTGCCCTTGG + Intronic
958268891 3:91473531-91473553 CAGATGCAGCCCCATGACCTGGG + Intergenic
959382267 3:105655260-105655282 GACATTCAGATCTATGACATAGG + Intergenic
960522250 3:118668432-118668454 CATTTGCAGCTCTGTGACCTTGG + Intergenic
961528086 3:127520617-127520639 CCCATCCAGCCATATGGCCTGGG - Intergenic
962628890 3:137256024-137256046 CACATACAGCTGTATGGCTTTGG + Intergenic
962964389 3:140339893-140339915 CACATCCAATTCTAAAACCTGGG - Intronic
964450377 3:156806895-156806917 ACCATCCAGCTGTGTGACCTTGG - Intergenic
966940797 3:184745766-184745788 AACAATCAGCTCTATGAACTGGG - Intergenic
967855589 3:194115129-194115151 CACATCCAGCCCTAGGTCCCGGG + Intergenic
968978830 4:3835888-3835910 CAAACCCAGCTCTGTGGCCTTGG + Intergenic
969371642 4:6735086-6735108 TACTTCTAGCTCTATGACCTTGG + Intergenic
969509472 4:7609598-7609620 CACGTCCTGCTCTGTGTCCTTGG + Intronic
969590991 4:8121893-8121915 CATTTGCAGCTCTGTGACCTGGG - Intronic
970099527 4:12504554-12504576 CACTTCTAGCTGTGTGACCTTGG - Intergenic
970189034 4:13492888-13492910 CAAATTCAGCCCTTTGACCTTGG - Intergenic
970693166 4:18643187-18643209 TACATCCAGCACTAAGAACTTGG - Intergenic
972749036 4:41970301-41970323 TACATACAGCTCTGTGACCTTGG + Intergenic
972865995 4:43233429-43233451 CACATGCAGCTCCTTGACCTTGG - Intergenic
975495975 4:75036393-75036415 TACTTCCAGCACTGTGACCTGGG + Intronic
976716853 4:88132195-88132217 CCCTTCCAGCTGTCTGACCTTGG + Intronic
977256630 4:94748119-94748141 CACATACTGCTCTGAGACCTTGG + Intergenic
982080686 4:151786771-151786793 CAAATCAAGCTATAAGACCTAGG + Intergenic
982109977 4:152045033-152045055 CACTTACAGCTCTTTGACCAGGG + Intergenic
984780393 4:183520422-183520444 CATATCCAGCACTATGGTCTTGG + Intergenic
985155562 4:186983893-186983915 CACAGCCAGCGATATGCCCTTGG + Intergenic
987140397 5:14939893-14939915 CACATCCATGGCTAGGACCTAGG - Intergenic
987255526 5:16146553-16146575 CTCCTCCAATTCTATGACCTTGG + Intronic
987378191 5:17257627-17257649 CACGTTCAGCTATGTGACCTGGG - Intronic
987477062 5:18403596-18403618 CACATCCAGGTTTGTGACATGGG + Intergenic
989125311 5:38047064-38047086 CATAACCAGCTGTGTGACCTCGG - Intergenic
990739567 5:58898344-58898366 CACCTACAGCTCTGTGGCCTTGG - Intergenic
991448506 5:66726677-66726699 TACCTCCTGCTGTATGACCTAGG - Intronic
992998744 5:82358383-82358405 CACATCCAGGCCTATGAAATGGG - Intronic
995344346 5:111094352-111094374 CTGATCCAGCTGTATGACCCTGG - Intronic
996000375 5:118354719-118354741 CATCAGCAGCTCTATGACCTTGG + Intergenic
996685327 5:126273729-126273751 CAGATACAGCACTTTGACCTGGG + Intergenic
997697355 5:135872136-135872158 CAGCTCCAGCTGTATGACCTGGG - Intronic
997793964 5:136788859-136788881 CACTTCCAGCTATATGACACTGG + Intergenic
998393755 5:141805008-141805030 CACCACCAGCCCTGTGACCTTGG + Intergenic
998492172 5:142556775-142556797 CCTTACCAGCTCTATGACCTTGG + Intergenic
998543906 5:143009418-143009440 CATTTCCAGCTGTCTGACCTTGG + Intronic
999742383 5:154566142-154566164 CCCACCCAGCTCTGTGCCCTGGG + Intergenic
1000048246 5:157539464-157539486 CACTTCCAGCTCTAAGTTCTGGG + Intronic
1000427272 5:161106490-161106512 CACTTACAGCTCTCTGACCTTGG - Intergenic
1000600742 5:163271873-163271895 CACAGCCAGCTGTGTAACCTAGG + Intergenic
1002091539 5:176809663-176809685 ACCTTCCAGCTCTGTGACCTTGG - Intergenic
1002181902 5:177435034-177435056 CACATCCGCATCTCTGACCTGGG + Exonic
1003291112 6:4778887-4778909 GACTTCCAACTCTATCACCTTGG + Intronic
1005609927 6:27514030-27514052 CACTCCTAGTTCTATGACCTTGG - Intergenic
1005894752 6:30168475-30168497 CTCCTCCAGCTCCTTGACCTGGG - Exonic
1007292462 6:40797971-40797993 AATTTCCAGCTCTATGACCTTGG + Intergenic
1007464199 6:42040494-42040516 TACAACCAGCTATATGACTTTGG + Intronic
1007752486 6:44078857-44078879 CTCATCCAGCTTGGTGACCTTGG + Intergenic
1007944784 6:45816529-45816551 CACATACAGCTCTGTTCCCTGGG - Intergenic
1008986339 6:57548191-57548213 CAGATGCAGCCCCATGACCTGGG - Intronic
1009174301 6:60440768-60440790 CAGATGCAGCCCCATGACCTGGG - Intergenic
1010785549 6:79995427-79995449 CTTATCCAGATCTGTGACCTGGG + Intergenic
1011409812 6:87056308-87056330 CAGATGCAGCTCCTTGACCTTGG - Intergenic
1012206506 6:96467244-96467266 CACAACCAGCTATGTGACCTTGG + Intergenic
1013009427 6:106106081-106106103 CACTTCTAGCTCTTTGACTTTGG + Intronic
1014564657 6:122932843-122932865 CAGTTCCAGACCTATGACCTGGG - Intergenic
1016640462 6:146342550-146342572 CACATCCAGCTGTGTGATCTTGG + Intronic
1016840104 6:148517253-148517275 CACTCACAGCTCCATGACCTTGG - Intronic
1017422540 6:154287539-154287561 CACACCAATCTGTATGACCTTGG - Intronic
1019834778 7:3371930-3371952 CACAACCTGCTCTATCTCCTGGG - Intronic
1020199917 7:6071721-6071743 CAGATGCAGCCCTTTGACCTTGG - Intergenic
1020471184 7:8536995-8537017 CACATACAGCTCTATGTTCTGGG + Intronic
1021769427 7:23983943-23983965 GACATCCAGCTCTCTGCCCATGG - Intergenic
1024045378 7:45582322-45582344 CACCTCCAGCTCCGTGACCTTGG + Intronic
1026300659 7:69095209-69095231 CATATCTAGCTCTATTACTTGGG - Intergenic
1026827670 7:73594409-73594431 CACAGGCAGCTCCTTGACCTGGG - Intronic
1027650305 7:80858758-80858780 CACATCCTCCTTTGTGACCTTGG + Intronic
1027741221 7:82008734-82008756 CAAATCCAACTTTATGAACTCGG - Intronic
1028278869 7:88895547-88895569 CACATCCAGCACCAAGATCTTGG + Intronic
1029736684 7:102469240-102469262 CACAGCCTGCTCTGTGGCCTCGG + Intronic
1030536325 7:110771491-110771513 CACTTTCAGCTGTGTGACCTTGG + Intronic
1032071979 7:128813541-128813563 CACATCCTGCTCCCTGATCTCGG - Intronic
1032507116 7:132443965-132443987 CACATCCACCTCAGTGAACTGGG + Intronic
1032953331 7:136941909-136941931 CAGTTCTAGCTATATGACCTGGG + Intronic
1033505718 7:141997711-141997733 CCTAGCCAGCTGTATGACCTTGG - Intronic
1036929034 8:12935256-12935278 GATATCCAGCTCTATGAAATTGG + Intergenic
1037522879 8:19697338-19697360 GACATCCAGGTCTATGGCTTTGG + Intronic
1037731326 8:21526161-21526183 CACACCCAGCTCCAGGACCTTGG + Intergenic
1038515771 8:28186611-28186633 TAGATCCAGCCCTTTGACCTTGG - Intronic
1038578338 8:28724892-28724914 CACTTCAAGCTCTGTTACCTAGG + Intronic
1039215841 8:35269827-35269849 CACACCCATCTGTGTGACCTTGG - Intronic
1039231297 8:35451540-35451562 CACCTACTGCTCTGTGACCTTGG - Intronic
1044414160 8:91917441-91917463 ACCAACCACCTCTATGACCTTGG - Intergenic
1046906674 8:119581357-119581379 CACACCCTGCTCTGTGGCCTGGG + Intronic
1047341370 8:123983597-123983619 TACATCCAGCTCTCTTACTTGGG - Intronic
1047799046 8:128289821-128289843 CACAAACTGCTCTATGAACTTGG - Intergenic
1048207052 8:132423700-132423722 CACTTACAGCTGTGTGACCTCGG - Intronic
1048258759 8:132926807-132926829 CACCACCAGCTCTGTGTCCTTGG - Intronic
1049337513 8:142094291-142094313 CACCTGCAGCTGTGTGACCTTGG + Intergenic
1050163401 9:2740713-2740735 CACATCTAACTCTTTGTCCTTGG + Intronic
1053042431 9:34885897-34885919 CACACCCAGCTCTCTGGCTTTGG + Intergenic
1053368074 9:37537873-37537895 CACATCCAGGTCCATGGCCCGGG - Exonic
1054801364 9:69352618-69352640 CACTTCTAGCTATGTGACCTTGG - Intronic
1054890616 9:70247008-70247030 CTCAACCTGCTCTATGCCCTGGG - Intergenic
1056566894 9:87781153-87781175 CAGATGCACCTCTGTGACCTTGG - Intergenic
1057268665 9:93635014-93635036 CTCTTCCAGCTGTGTGACCTTGG - Intronic
1058710741 9:107676932-107676954 CACATCCATCTCTTTGAGCTTGG + Intergenic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1060777653 9:126387865-126387887 CACTTCCAGATGCATGACCTTGG - Intronic
1061513990 9:131077948-131077970 CCACTCCAGCTCTGTGACCTCGG + Intronic
1061648392 9:132025601-132025623 CTTAACCAACTCTATGACCTTGG + Intronic
1061971670 9:134048623-134048645 CACTGCCAGCTGTGTGACCTTGG - Intronic
1062174531 9:135153601-135153623 GACATCCAGCTGTGTGGCCTGGG + Intergenic
1185533189 X:838419-838441 CACATGCAGCTTTGTGACCTGGG - Intergenic
1189996269 X:46641794-46641816 CACTTAAAGCTCTGTGACCTTGG + Intronic
1190459664 X:50659744-50659766 CATTTCCAGCTGTATGTCCTTGG + Intronic
1190643311 X:52501661-52501683 TTCATCCAGCTCTATAGCCTAGG - Intergenic
1190644361 X:52511206-52511228 TTCATCCAGCTCTATAGCCTAGG + Intergenic
1190653401 X:52589886-52589908 TTCATCCAGCTATATGGCCTAGG - Intergenic
1190733063 X:53237159-53237181 CATTTCCAGCTGTATGACCCTGG - Intronic
1192226386 X:69231093-69231115 TGCATCCTGCTCTGTGACCTTGG + Intergenic
1196050470 X:111298580-111298602 CCCAGCCAGCTGTGTGACCTTGG + Exonic
1196376880 X:115042959-115042981 CCCAGTCAGCTCTGTGACCTTGG + Intergenic
1197757526 X:130006315-130006337 CACACACAGCTCTTTGACCAAGG - Intronic
1198431953 X:136576344-136576366 CTCATCCAACTGTGTGACCTTGG + Intergenic
1199492608 X:148417562-148417584 CACTTCTAGCCGTATGACCTTGG - Intergenic
1199838991 X:151624477-151624499 CCCTACCAGCTCTGTGACCTTGG + Intronic
1202039636 Y:20668406-20668428 CAAATCCAGGTCTCTTACCTTGG + Intergenic