ID: 912620778

View in Genome Browser
Species Human (GRCh38)
Location 1:111155027-111155049
Sequence CTGAAACTATTCCAAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 5, 2: 28, 3: 108, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912620778_912620781 26 Left 912620778 1:111155027-111155049 CCAGTATTTTGGAATAGTTTCAG 0: 1
1: 5
2: 28
3: 108
4: 384
Right 912620781 1:111155076-111155098 TTGGTAGAATTCAGCAGTAAAGG 0: 2
1: 23
2: 37
3: 109
4: 246
912620778_912620780 7 Left 912620778 1:111155027-111155049 CCAGTATTTTGGAATAGTTTCAG 0: 1
1: 5
2: 28
3: 108
4: 384
Right 912620780 1:111155057-111155079 GGTGTAGTTCTTTAAAAGTTTGG 0: 1
1: 1
2: 7
3: 56
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912620778 Original CRISPR CTGAAACTATTCCAAAATAC TGG (reversed) Intronic
901311272 1:8271163-8271185 GTGAGACTTTTCCAGAATACAGG + Intergenic
903094567 1:20957996-20958018 CTGAAACTATTCCAAGTGACTGG + Intronic
905487313 1:38311463-38311485 TTGAAACTATTTCAAAGTATTGG - Intergenic
905983340 1:42252167-42252189 CTGAAACTATTCCAATCAATAGG - Intronic
906077700 1:43064134-43064156 CTGAACCTAGTCCACAATTCAGG + Intergenic
906836597 1:49089692-49089714 CTGAAACTATTCCAAAAAATTGG + Intronic
907994341 1:59614095-59614117 CTGAAACTATTCCAATCAATAGG + Intronic
908164116 1:61440859-61440881 CTAAAACTTTTGAAAAATACTGG - Intronic
908584285 1:65551259-65551281 CTGAAATTATTCTAAACAACAGG - Intronic
909083954 1:71149878-71149900 CTGAAACTATTCCAATCAATAGG + Intergenic
909372503 1:74900232-74900254 CTGAAACTATTCCAATCAATAGG - Intergenic
909644104 1:77897106-77897128 CTGAAACTATTCCAATCAATAGG + Intronic
910407241 1:86901752-86901774 CTAAAATTATACCAAAAAACTGG + Intronic
910786235 1:91001132-91001154 CTGAAACTATTCCAATCAATAGG + Intronic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
911879330 1:103214839-103214861 CTGACACTCTTCACAAATACAGG - Intergenic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
913360553 1:117975791-117975813 CAAAAACTATACCAAACTACTGG - Intronic
913663420 1:121025509-121025531 CTAAAACTATTCCAAAAAATTGG + Intergenic
914014811 1:143808777-143808799 CTAAAACTATTCCAAAAAATTGG + Intergenic
914163010 1:145152430-145152452 CTAAAACTATTCCAAAAAATTGG - Intergenic
914653432 1:149717334-149717356 CTAAAACTATTCCAAAAAATTGG + Intergenic
915404867 1:155652195-155652217 ATGAAACTATTCCTAATTAAGGG - Intergenic
915810795 1:158908107-158908129 CTGAAACTGTTCCAAAAATCTGG + Intergenic
917427961 1:174935134-174935156 CTGAAACCATTTTAAAATTCAGG - Intronic
917718584 1:177762977-177762999 CTGAAACTATTCCAATCAATAGG + Intergenic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
919545646 1:198914844-198914866 CTGAAATTATTCCAACATGCAGG + Intergenic
920336059 1:205246113-205246135 TTGAAACCAATCCAGAATACAGG - Intronic
921655569 1:217732114-217732136 AAGAAACTATTACAAAATAGTGG - Intronic
921787811 1:219252827-219252849 CAGAAACCGTTCCAAAAAACTGG - Intergenic
923730971 1:236549447-236549469 CTGAAAATATTCCTAAATCCTGG - Exonic
924156955 1:241187526-241187548 CTGCAATTATTCCAAACAACTGG - Intronic
1062994845 10:1856118-1856140 CTGTAATTTTTCCAAATTACTGG - Intergenic
1063181959 10:3610596-3610618 CTGAAACTATTTCAAAAATAAGG + Intergenic
1063340196 10:5255738-5255760 CTGAAACTATTCCAATCAATAGG + Intergenic
1063915694 10:10879798-10879820 GTGAAACTCTTTGAAAATACTGG - Intergenic
1065784473 10:29200847-29200869 ATGAAACTATTCAAACATACAGG + Intergenic
1066014892 10:31231444-31231466 CTGAAACTATTCCAAACAATTGG + Intergenic
1068055559 10:52008731-52008753 TTGAAACTGTTCCAAAAAACTGG - Intronic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1069072318 10:64001923-64001945 CTGAAACTACTCCAAAAAATTGG + Intergenic
1069315746 10:67098904-67098926 TTGAAATGTTTCCAAAATACCGG - Exonic
1070632868 10:78100252-78100274 CTGAAACTATTCCAAACAATAGG + Intergenic
1070870881 10:79751568-79751590 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071637807 10:87273779-87273801 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071657437 10:87464171-87464193 TAAAAACTATTCCAAAAAACTGG - Intergenic
1072032356 10:91533230-91533252 CTGAAACTATTCCAATCAATAGG + Intergenic
1072311667 10:94162200-94162222 CTGAAACTATTCCAATCAATAGG - Intronic
1074179548 10:111046724-111046746 CTGAAACTATTCCAATCAATAGG + Intergenic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1079203697 11:18395844-18395866 CTGAAACTATTTCTTCATACTGG + Intronic
1079814293 11:25036010-25036032 CTGAAACTATTCCAAAAAGCTGG - Intronic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1080914501 11:36642454-36642476 CTGAAACTATTCCAATGAATAGG + Intronic
1081084521 11:38782862-38782884 CTTAAAGTATTTCAAAATATAGG + Intergenic
1081399212 11:42623340-42623362 CTGAGTCTCTTCCAAAATACAGG + Intergenic
1081816165 11:45944001-45944023 GAGAAACTCTTCCAAAATAAAGG + Intronic
1082316045 11:50723693-50723715 CTGAAACTATTCCAATCAATAGG + Intergenic
1082865152 11:57892965-57892987 CTCAAACTATTCCAGAAAATTGG - Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1082936030 11:58657879-58657901 CTGAAAGTATCCAGAAATACAGG + Intronic
1084624986 11:70299586-70299608 CTGAAACAATCACAAAACACAGG - Intronic
1085768215 11:79302594-79302616 CAGAAAATATTCATAAATACAGG - Intronic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1086923953 11:92619401-92619423 CACAAACTCTTCCAAAATATAGG - Intronic
1087077130 11:94135448-94135470 CTGAAGATATTCCCAAAGACAGG - Intronic
1087442356 11:98202507-98202529 CTGAAACTATTCCAATCAATTGG + Intergenic
1087485167 11:98751433-98751455 CTGAAACTATTCCAAACAATAGG + Intergenic
1087719164 11:101642485-101642507 CTGAAACTATTCCAATCAATAGG + Intronic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1091598153 12:1894332-1894354 CTCAAGTTATTCCAAAATATTGG + Intronic
1091810661 12:3394755-3394777 CTGAAACTATTCCAATCAATAGG - Intronic
1091824573 12:3501744-3501766 CTGAAACTATTCCAATCAATAGG - Intronic
1091943496 12:4512337-4512359 CTGAAACTATTCCAATCAATAGG + Intronic
1092085427 12:5754458-5754480 CTTAAAGTCTTCCAAAAAACAGG - Intronic
1092325251 12:7524428-7524450 CTGAAACTATTCCAAGCAATTGG - Intergenic
1092648529 12:10606893-10606915 ATGGAACTATTCCTAAATATTGG - Intronic
1093992576 12:25606876-25606898 CTGAAACTATTCCAATCAATAGG - Intronic
1094184133 12:27623228-27623250 CTGATACTCCTCCATAATACTGG + Intronic
1094873223 12:34611050-34611072 CTGAAACTATTCCAATCAATAGG - Intergenic
1095228272 12:39702531-39702553 CTGAAACTATTCCAATCAATAGG + Intronic
1095298395 12:40553479-40553501 ATGAAACTATTCCAAAAAATTGG - Intronic
1095367654 12:41427261-41427283 GTGAAAATATTCCAAAAAACAGG - Intronic
1095664730 12:44784477-44784499 CTGAAACTGTTCCAAACAAAAGG + Intronic
1095780449 12:46053226-46053248 CTGCAACTATTCTAAAAAATGGG + Intergenic
1096332759 12:50728758-50728780 CTGAAACTTTACCAAATTAAGGG - Intronic
1096346682 12:50853923-50853945 CTAAAACTATTCAAAAAAATTGG + Intronic
1097418866 12:59348922-59348944 CTGAAACTATTCCAAACAATAGG - Intergenic
1097753194 12:63380547-63380569 CTGAAACTATTCCAAACAATAGG + Intergenic
1098053568 12:66479517-66479539 CTGAAACTATTCCAAACAGTAGG + Intronic
1098634237 12:72761503-72761525 CTCAAACTGTTCCAAAATCTTGG + Intergenic
1099372341 12:81851035-81851057 CTGAAATTATTAAGAAATACAGG - Intergenic
1101028748 12:100639367-100639389 CTGAAACTATTCCAATCAATAGG - Intergenic
1101124683 12:101619723-101619745 CTGAAAATGTACCAAAATCCAGG - Intronic
1102106443 12:110328185-110328207 CTAAAACTTTCACAAAATACAGG + Intronic
1103519549 12:121528936-121528958 TTGACACTATTCCAAAAGAGAGG + Intronic
1104262299 12:127195456-127195478 CTGAAATTATTCCAAAAAAGAGG + Intergenic
1104798017 12:131533210-131533232 CTGAAGCTATTCCCAGATCCAGG - Intergenic
1105002313 12:132698561-132698583 ATGAGAATATTTCAAAATACTGG - Intronic
1106837148 13:33646709-33646731 CTGTAACTATTCTGAAATTCTGG + Intergenic
1107187543 13:37541953-37541975 CTGAAACTATGCCAAAAATTGGG - Intergenic
1108130541 13:47294967-47294989 CTGAAACTATTCCAAACAATTGG - Intergenic
1108137513 13:47381714-47381736 CTGAAACTATTCCAATCAATAGG + Intergenic
1108168343 13:47715737-47715759 CTGAAACTATTCCAATCAATAGG + Intergenic
1108175201 13:47785349-47785371 CTGAAACTATTCCAATCAATAGG + Intergenic
1109150262 13:58838384-58838406 CTGAAACTATTCCTAACTTGAGG - Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1110985377 13:81960628-81960650 CTGAAACTATTCCAAAACAATGG + Intergenic
1111431824 13:88155656-88155678 CTGCAACTATTTTCAAATACAGG - Intergenic
1111783293 13:92755927-92755949 CTGAAACTATTCCAATCAATAGG + Intronic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1112898686 13:104333694-104333716 CTGATGCTATTCCATAATAATGG + Intergenic
1113169810 13:107487823-107487845 CTGAAACTATTCCAAAAAATGGG - Intronic
1114126050 14:19727165-19727187 CTGAAACTATTCCCAAAAATGGG - Intronic
1114808104 14:25861439-25861461 TTGAAACTATTAGGAAATACTGG + Intergenic
1115056559 14:29135019-29135041 CTGAAAGTATTCCAAACTATCGG - Intergenic
1116022877 14:39482992-39483014 CTGAAACTATTCCAATCAATAGG + Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116182839 14:41557107-41557129 CTGAAAGTCTTCCTAAATATTGG - Intergenic
1116193251 14:41687003-41687025 CTGAAACTATTCCAAACAATTGG - Intronic
1116230349 14:42207446-42207468 CTGAAACTATTCCAATCAATAGG - Intergenic
1116274558 14:42814459-42814481 CTCAAACTCTTCCAAAAAAATGG - Intergenic
1116318209 14:43425459-43425481 CTGAAACTATTCCAAACAATAGG + Intergenic
1116508217 14:45711953-45711975 CTGTTTCTCTTCCAAAATACAGG - Intergenic
1116532070 14:45984378-45984400 CTCAAACTCTTCCAATATATTGG - Intergenic
1116549754 14:46221931-46221953 CTAAAAGTATTGCAAAAAACAGG + Intergenic
1116579569 14:46622082-46622104 CTGAAACTATTTCAAACAATAGG + Intergenic
1117086994 14:52211726-52211748 CTGAAACTATTCCAATCAATAGG + Intergenic
1117188654 14:53268953-53268975 CTGAAACTATTCCAATCAATAGG - Intergenic
1117502774 14:56370536-56370558 CTAAAACTATTCCAAAAAATTGG - Intergenic
1117775535 14:59180458-59180480 CTGAAACTTTTCAAAAATAATGG - Intergenic
1119060925 14:71473407-71473429 CTGAAACTATTTCTAAACTCAGG - Intronic
1119084446 14:71727244-71727266 AAGAAACTCTTCCTAAATACTGG - Intronic
1119111476 14:71978807-71978829 CTGAAACTATTCCAATCAATAGG - Intronic
1119820203 14:77609257-77609279 GTGAAAGTATTTAAAAATACAGG - Intronic
1123502905 15:20907232-20907254 CTTAAACTATTTCAAAACAGAGG + Intergenic
1123560152 15:21480894-21480916 CTTAAACTATTTCAAAACAGAGG + Intergenic
1123596393 15:21918198-21918220 CTTAAACTATTTCAAAACAGAGG + Intergenic
1124033512 15:26032555-26032577 CTGGGACTAAGCCAAAATACTGG - Intergenic
1124209353 15:27750262-27750284 CTGTAACTTTTTCAATATACAGG - Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1126520357 15:49586125-49586147 TTCAAACTATTACAAACTACAGG + Intronic
1127024865 15:54793035-54793057 ATAAAACAATTCCCAAATACAGG + Intergenic
1127094973 15:55503372-55503394 CTGAAACTATTCCAATCAATCGG + Intronic
1131634041 15:94210826-94210848 CTGAAACTATTCCAATCAATAGG - Intergenic
1132360551 15:101209740-101209762 CAGAAACTGTTCCAACAGACAGG + Intronic
1202968500 15_KI270727v1_random:208058-208080 CTTAAACTATTTCAAAACAGAGG + Intergenic
1133487571 16:6234998-6235020 CTGTAATTATTTCAAAATAAAGG + Intronic
1134431295 16:14209463-14209485 ATGAGACTATTTCAAAATAAGGG - Intronic
1135192402 16:20365505-20365527 GTGAAGAGATTCCAAAATACTGG - Exonic
1138359711 16:56417765-56417787 ATGCAAATATTCCAAAATCCAGG + Intronic
1138469384 16:57220948-57220970 CAGCAACATTTCCAAAATACAGG - Intronic
1138704214 16:58897642-58897664 TTGAAACTCTTACAAAATATAGG - Intergenic
1139398166 16:66657659-66657681 CTGTAATTATTTCAAAATAAAGG + Intronic
1139714933 16:68805446-68805468 CTGAAAATATTCCACAGTCCTGG + Intronic
1140597034 16:76428632-76428654 CTGAAAACATCACAAAATACAGG - Intronic
1140610697 16:76595216-76595238 CTAAAACTATTAGACAATACTGG - Intronic
1140883731 16:79223957-79223979 CTGAAACTATTGCAAACAATAGG + Intergenic
1143924792 17:10360004-10360026 CTGCAATTGTTGCAAAATACTGG + Exonic
1144592278 17:16534815-16534837 CTTAAACTTTTCCATAATAATGG + Intergenic
1146106841 17:30046625-30046647 ATGTAACTATTCCAAATTTCAGG - Intronic
1149675133 17:58453136-58453158 CTTAAACTATTCCAAAAAATTGG + Intronic
1150527675 17:65939779-65939801 CTAAAACTAGTAGAAAATACAGG + Intronic
1151028959 17:70713002-70713024 GGGAAACTATTCCCAAATAAAGG - Intergenic
1151688348 17:75663193-75663215 CTGCAAATATTCCTAAATCCAGG - Intronic
1153493398 18:5672833-5672855 CTAAAGCTATTACAAAATCCTGG + Intergenic
1153498207 18:5721674-5721696 CTGGACCTATTCCACAATAATGG + Intergenic
1153563755 18:6398677-6398699 CTCACACTATTCCAAAACCCAGG + Intronic
1153827241 18:8886610-8886632 CTGAAACTATTTCAATCAACAGG - Intergenic
1153979434 18:10296659-10296681 CTGAAACTGTTCCAGAAGAGAGG - Intergenic
1154407869 18:14111869-14111891 CTTAAACTATTCCAAAACAGAGG + Intronic
1155418125 18:25623391-25623413 ATGAAACTCTTCCAGAAAACTGG - Intergenic
1156296265 18:35794186-35794208 CTGAAACTATTCCAATCAATAGG + Intergenic
1156317750 18:35986589-35986611 CTGAAATAATTCCAAATTATTGG + Intronic
1156606859 18:38676680-38676702 TTGACACTATTCCAAAAAATAGG - Intergenic
1156877794 18:42037085-42037107 ATGCAAATATTCCAAAATCCGGG + Intronic
1156896453 18:42252243-42252265 CTAAAAGTATTCCAAAAAATTGG - Intergenic
1157178517 18:45474421-45474443 CTGAAACTATTCCAAACAGTAGG - Intronic
1159200662 18:65179844-65179866 CTTAAACTTTTCCAAGAGACAGG - Intergenic
1159501575 18:69278191-69278213 CTGAAACTATTCCTGAACAAGGG - Intergenic
1159849441 18:73510022-73510044 CTGAGAATATTCCAAAATTATGG + Intergenic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
1160471907 18:79143515-79143537 CTGAAACAATTACAAAACATGGG + Intronic
1161753099 19:6111431-6111453 TTTAAACTAGTTCAAAATACTGG - Intronic
1162243228 19:9375388-9375410 CTCAAACTCTTCCAAAAAAATGG - Intronic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1163264658 19:16212145-16212167 CTGAAATGATTCCAAAAAAACGG - Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1163955282 19:20632740-20632762 ATCAAACTATTCCAAGCTACAGG - Intronic
1163972397 19:20811272-20811294 CTGAAACTATTCCAATCAATGGG + Intronic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1165298357 19:34947732-34947754 CAGAAACTCTTCCAAAAAAGTGG + Intergenic
1166585690 19:43946198-43946220 CTGAAACTATTTCAAGAAACAGG - Intergenic
1167407306 19:49320958-49320980 CTCAAACTTTTCCAAAAAATTGG + Intronic
926852876 2:17220261-17220283 TTAAAACTTTTCCAAAAGACAGG + Intergenic
928988754 2:37208244-37208266 CTGAAACTATTCCAAAAGATAGG + Intronic
929401351 2:41585544-41585566 TTGAAACTATACCAAAAAATTGG + Intergenic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
931204342 2:60132737-60132759 CTGAAACTATTCCAATCAATAGG - Intergenic
931488757 2:62721900-62721922 CTGAAATTATTTCAAAATAAAGG - Intronic
931534017 2:63251883-63251905 CTGAAACTATTCCAAAAATCAGG + Intronic
933617830 2:84501571-84501593 CTCAAACTATTCCAAAAACTAGG - Intergenic
934111090 2:88743581-88743603 CTGAAACTATTCCAAAAGATGGG - Intronic
934996311 2:98964210-98964232 CTGAAACTATTCCAAAAATTGGG - Intergenic
936847672 2:116856131-116856153 ACGAAACTATTCCAAAATTGAGG + Intergenic
937188625 2:120070428-120070450 CTGAAACTATTACAAACAATAGG + Intronic
937754506 2:125519807-125519829 CTGAAATTGTTCCAAAACATTGG + Intergenic
938425657 2:131184678-131184700 CTGAAACTATTCCAAAAAGAGGG + Intronic
938975388 2:136472288-136472310 CTGAAACTATTCCAATCAATAGG + Intergenic
941050979 2:160733788-160733810 CTGGAACTATTCCAGATTAAAGG - Intergenic
941135879 2:161717836-161717858 CTGAAACTATTCCAAACAATTGG - Intronic
941749947 2:169124520-169124542 CTGAAATGATTCCAAAAAAGAGG + Intergenic
941760517 2:169237240-169237262 CTGAAACTATTGCAATAGATTGG - Exonic
942796656 2:179828754-179828776 CTGAAAATATTTCACAAAACTGG + Intronic
943090136 2:183364357-183364379 CAGACACTCTTCCAGAATACTGG + Intergenic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
943563056 2:189486033-189486055 CTGAAACTGTTCCAAAGGAGTGG + Intergenic
943681673 2:190774791-190774813 CTGAAACTATTCCAATCAATAGG - Intergenic
944393277 2:199242132-199242154 CTGAAACTATTCCAATCAACAGG - Intergenic
944737444 2:202580435-202580457 CTGAAACTGTTCCAAAAAATCGG - Intergenic
944902211 2:204226965-204226987 CAGAAAGTATTTCCAAATACAGG - Intergenic
945243112 2:207694860-207694882 CAGATACTGTTCCAAAATACCGG - Intergenic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
945647121 2:212511436-212511458 TTGAAACTATTACAAAATTTAGG + Intronic
947322213 2:228933010-228933032 CTGAAACTATTCCAAACAATAGG - Intronic
1169492061 20:6079664-6079686 CTGAAATGATTCAGAAATACTGG - Intronic
1169980927 20:11383134-11383156 CTAAAACTATTCCAAACAATTGG + Intergenic
1170675836 20:18479954-18479976 CTTAAACTGTTCCAAAATATAGG + Intronic
1171225495 20:23438946-23438968 CTGAAATTATTCCAAAATAAAGG - Intergenic
1171362219 20:24595541-24595563 CTGAAACTATTACAAAAAAGTGG - Intronic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1176776166 21:13135360-13135382 CTGAAACTATTCCAATCAATAGG + Intergenic
1177198922 21:17931733-17931755 CTGAAGGAATTACAAAATACAGG + Intronic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1177621887 21:23606311-23606333 CTGAAACTATTCCAAAAAATTGG + Intergenic
1182167900 22:28194883-28194905 CTGAAACTATTCCAATCAATAGG + Intronic
1182169505 22:28212726-28212748 CTGAAACTATTCCAATCAATAGG + Intronic
1183927751 22:41218006-41218028 CTGAAACTATTAGAGAATTCAGG - Intronic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
949181925 3:1142410-1142432 CTGCAGCTACTTCAAAATACAGG + Intronic
950844629 3:16002667-16002689 CTGCAAAAATTCCAAAAAACAGG - Intergenic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
951654964 3:24996002-24996024 TTCAAACTATTACAAAATATTGG - Intergenic
952605047 3:35136191-35136213 ATGTGACTATTCCAAAATACTGG + Intergenic
952836062 3:37603234-37603256 GTGAAAATATTCCAAAAAAATGG + Intronic
953431240 3:42842318-42842340 CTGATAATATTCCATAAAACAGG + Intronic
954497174 3:50975686-50975708 CTGAAACTATTCCAATCTATAGG - Intronic
955134426 3:56201896-56201918 CTGAAACTGATCCAGAAAACAGG - Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
956999492 3:74868882-74868904 CTGAATCTATACCAAATTCCAGG - Intergenic
957116367 3:76031909-76031931 CTGAAACTATTCCAATCAATAGG - Intronic
957171984 3:76749894-76749916 CTGCAACTATTCCAATCGACAGG + Intronic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
957628576 3:82687794-82687816 CTGAAACTATTACAAAATAGAGG - Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
957825179 3:85432376-85432398 TTGAACCTTTTCCAAAATGCAGG - Intronic
957907830 3:86580146-86580168 CTGAAACTGTTTCAAAATTGAGG + Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
958789936 3:98640265-98640287 CTGAAGCTATTCCAAAAGATAGG - Intergenic
960276899 3:115738919-115738941 CTAAAACTATTCCAAACAATTGG - Intergenic
960308854 3:116096143-116096165 CTGAAGCTCTTCGAAAATATTGG - Intronic
960763726 3:121101189-121101211 CTGATATTATTCCAAAATTCAGG + Intronic
961229659 3:125292596-125292618 CTGAAACTGTTACAAAATACAGG - Intronic
962038397 3:131678971-131678993 CTGAAACTATTTCAAAAAATTGG - Intronic
963689582 3:148481731-148481753 CTGAAACTATTCCAATCAATAGG + Intergenic
964519528 3:157548718-157548740 CTAAAACTCTTCAAAAAAACTGG - Intronic
964907109 3:161730471-161730493 CTGAAACTAACCCAAACCACAGG + Intergenic
965161311 3:165136925-165136947 CTGAAACTATTCCAATCAATAGG - Intergenic
965217317 3:165879980-165880002 CTGAAACTATTCCAATCAATAGG - Intergenic
965223900 3:165962451-165962473 CTGAAACTATTCCAATCAATAGG + Intergenic
965782158 3:172297306-172297328 TTGAAACTATTCCAAATAAAAGG - Intronic
966551341 3:181207503-181207525 CTGAAACTATTGGAAAAGCCTGG + Intergenic
966637111 3:182147838-182147860 ATGAAAAGACTCCAAAATACTGG - Intergenic
967203582 3:187098466-187098488 CTGAAACTATTCCAAAAGATAGG + Intergenic
969827594 4:9769920-9769942 CTGAAATTATTTGAAAATAAGGG - Intergenic
970371379 4:15410334-15410356 CAGAAAATATACCAAAATGCTGG - Intronic
971466845 4:26972784-26972806 CTGAAACTATTCCAATCAACAGG - Intronic
971656765 4:29357019-29357041 CTCAAACTCCTCCAAAATATTGG - Intergenic
971679362 4:29676738-29676760 CTGAAACTATTGCAAATAATAGG + Intergenic
971720666 4:30241337-30241359 CTGAAACTATTCTAAAAGATAGG - Intergenic
972125734 4:35762182-35762204 CTGAAACCATTCAAAAAATCAGG + Intergenic
972755898 4:42045669-42045691 CTGAAACTATTCCAAACAATAGG + Intronic
973083797 4:46029158-46029180 ATGAAACAATTCCAAAAAAGTGG + Intergenic
974265904 4:59585484-59585506 CTGAAACTATTACAAATAATAGG + Intergenic
974342225 4:60628898-60628920 CTGAAACTATTCCAAACAATAGG - Intergenic
974496650 4:62637625-62637647 TTGAAAATATTCCAAATCACAGG + Intergenic
974966292 4:68764530-68764552 CTGAAGCTATTTCAAAAAATTGG + Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
976325576 4:83767613-83767635 CTGAAAATAATCCAAAAAAGAGG - Intergenic
976490418 4:85664055-85664077 CTGAAACTATTCCAATCAATAGG - Intronic
977060435 4:92252572-92252594 TTGAAACTATTCCAAACAATTGG - Intergenic
977199868 4:94102492-94102514 CTGAAACTATTCCAATCAATAGG + Intergenic
977351298 4:95891310-95891332 CTCAAATTTTTCCAAAATAGTGG + Intergenic
977530028 4:98190006-98190028 CTGAAACTATTCCATGATCTGGG - Intergenic
977982835 4:103345557-103345579 AAGAAAATATACCAAAATACTGG - Intergenic
977994780 4:103488348-103488370 CTGAAGCTATTCCAAATAATAGG + Intergenic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978199592 4:106010052-106010074 TTGACACTATTCCAAAAGATAGG - Intergenic
979234953 4:118389286-118389308 TAGAAAATATTCCAAAATATGGG - Intergenic
979658685 4:123226754-123226776 CTGAAACTATTCCAATCAACAGG - Intronic
979712411 4:123795197-123795219 CTGAAACCATCCCAAAAGATAGG - Intergenic
979984752 4:127299964-127299986 TTGACACTATTCCAAAAGATAGG + Intergenic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981846022 4:149170512-149170534 ATGAAAATATTGCAAAATGCAGG - Intergenic
983497698 4:168461866-168461888 CTGAAACTATCAGAAAATACGGG + Exonic
983703830 4:170632882-170632904 ATGAAACTATTCTAAAATTATGG + Intergenic
983730564 4:170988406-170988428 CTGAAACTCTTCCAAAATATCGG - Intergenic
983912426 4:173255052-173255074 CTGAAATTATTTTAAAAAACAGG + Intronic
984101191 4:175488422-175488444 CTGGAACTATTCCAAACAATAGG + Intergenic
984340201 4:178447348-178447370 CTGAAACTATTCCAATCAATAGG - Intergenic
984792382 4:183626541-183626563 CTTAAAATATTCAAAAAAACAGG - Intergenic
987537935 5:19212084-19212106 CTCAAACTATTCTGAAAAACAGG + Intergenic
987554930 5:19434425-19434447 CTGAAACTGTTCCAAACGATAGG - Intergenic
987564059 5:19561939-19561961 GTGATACAATTTCAAAATACAGG + Intronic
987674541 5:21058659-21058681 CAGAAACTATTCCAAAGAATCGG - Intergenic
988189174 5:27905535-27905557 CTGAGAATATGCCAAAATTCAGG - Intergenic
989186340 5:38630546-38630568 ATCAAACTACTCCAAACTACAGG - Intergenic
989777617 5:45227746-45227768 CAGAAACTATTATAAAACACTGG - Intergenic
989789204 5:45374596-45374618 CTTAAACTATTCCAAAAACTTGG + Intronic
990409374 5:55525635-55525657 CTGAAACTAGTCTAAAATTGGGG - Intronic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
991323788 5:65406690-65406712 CTGACACTATTCCAATCAACAGG - Intronic
991545914 5:67781203-67781225 ATCAAACTACTCCAAACTACAGG + Intergenic
991624230 5:68582600-68582622 CAGTAACAATTCCAAAATATTGG + Intergenic
992756799 5:79914548-79914570 CTGAAACTATTCCAATCAATAGG + Intergenic
992757051 5:79917289-79917311 CTGAAACTATTCCTGAAAATTGG + Intergenic
992842493 5:80709951-80709973 CTGAAAATATTCCTTAATGCTGG + Intronic
993103000 5:83564407-83564429 AAGAAACTATTCAAAACTACAGG - Intronic
993205778 5:84876607-84876629 CTCAAACTGTTCCAAAAAATAGG + Intergenic
994015375 5:94958867-94958889 CTAAAACTATTCCAAACAATAGG + Intronic
994057549 5:95435380-95435402 CTCAAATTATTCCAAAAAGCAGG - Intronic
994434575 5:99710940-99710962 CTGAAACTATTCCAATCAATAGG - Intergenic
994707893 5:103228185-103228207 CTAAAACTATTCTGAAAAACTGG + Intergenic
995730889 5:115240447-115240469 CTTAAGCTAATCCAGAATACAGG - Intronic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996130281 5:119773126-119773148 CTGAAACTATTCCGAACAATAGG + Intergenic
996274142 5:121644154-121644176 TTGAAACTATTCCAAAAATTTGG + Intergenic
996307520 5:122066358-122066380 CTGAAACTTTTCTAAAGTGCTGG - Exonic
996454728 5:123667661-123667683 CTGAAAGTACTCTAAAAAACTGG + Intergenic
998927102 5:147138511-147138533 CTGAAACTATTCCAAACAATAGG - Intergenic
999350788 5:150869523-150869545 TTGAAACTATTCCAAAAGATAGG - Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
999567127 5:152876820-152876842 TGGAAACTTTTCCAAAAAACTGG + Intergenic
999834723 5:155357000-155357022 CTTAAACTATTCCAAATTTGAGG + Intergenic
1004287417 6:14334770-14334792 ATGACACTATCTCAAAATACTGG - Intergenic
1004749589 6:18548071-18548093 CTGAAACTATTCCAATCAATAGG - Intergenic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005208188 6:23429220-23429242 ATGAAACTATTCCAAACAATAGG - Intergenic
1005346546 6:24896104-24896126 GTGAAACTATTGGAAAACACAGG - Intronic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1005416637 6:25606747-25606769 CTAAAACTATTCACAAAAACAGG - Intronic
1005856336 6:29865793-29865815 CTGAAAATTTTGCAAAATTCTGG - Intergenic
1008069647 6:47086427-47086449 CCCAAATTAGTCCAAAATACTGG + Intergenic
1008641708 6:53469869-53469891 CTGAAACTACTCCAAAAAATAGG - Intergenic
1009277503 6:61701979-61702001 CTGCAACCAGTCCAAAATCCAGG - Intronic
1009558460 6:65206482-65206504 CTGCAACTATTCCAAAAATTTGG + Intronic
1010271320 6:73918693-73918715 ATGAAACTACTCCGAACTACAGG + Intergenic
1010466200 6:76169230-76169252 CTATAACTATTCCAAAACACAGG + Intergenic
1010654804 6:78499688-78499710 CAGAAATTATTACAAAAAACTGG - Intergenic
1011002859 6:82610720-82610742 CTGAAATTATTTCAAAATAAAGG + Intergenic
1011377329 6:86703638-86703660 CTGAAACTATTCCAAACAGTTGG - Intergenic
1011386717 6:86806115-86806137 CTGAAACTATTTCAAATGATAGG - Intergenic
1011876964 6:91973676-91973698 CTGAAACTATTCCAATCAATAGG + Intergenic
1012130722 6:95488908-95488930 CTAACACTGTTCCAAAATCCAGG - Intergenic
1012220332 6:96641240-96641262 CTGAAACTATTCCAATCAATAGG + Intergenic
1012253381 6:97005025-97005047 CTAAAACTATTCAAAAACATTGG - Intronic
1012673963 6:102091657-102091679 CTGAAACTATTCCAATCAATAGG + Intergenic
1012783428 6:103591923-103591945 CGGAAACTATTCCAATCAACAGG - Intergenic
1012813531 6:103991188-103991210 CAGAAACTAATCCAAAAAAGTGG + Intergenic
1013452190 6:110294673-110294695 CTAAAACTATATCAAAATAATGG + Intronic
1013895597 6:115084164-115084186 CTGAAACTATTCCAATCAATAGG + Intergenic
1013964530 6:115938924-115938946 CTGAAACTATTCCAAACAATAGG + Exonic
1014058127 6:117040311-117040333 CTGAAACTATTCCAAACAATAGG - Intergenic
1014658503 6:124136453-124136475 CTGAAACTATTCCAAAAGATGGG + Intronic
1015900140 6:138056556-138056578 CTAAAACTATTCCAAAAGATAGG + Intergenic
1016457976 6:144250865-144250887 CTCAAACTATTCAATAACACTGG + Intergenic
1016774725 6:147892762-147892784 CTGAAAGAATTTCAAAATACAGG - Intergenic
1017279046 6:152604116-152604138 CTGAAAATATTCCATAGTAATGG - Intronic
1018883344 6:167907324-167907346 CTGAAAGTATTCCTAAAAAAGGG + Intronic
1018971509 6:168532537-168532559 CTGAAGCTATATCCAAATACTGG - Intronic
1019096206 6:169581931-169581953 ATGAAATTATTCCCAAACACTGG + Intronic
1020546321 7:9536486-9536508 CTGAAACTATCCCAAAATACTGG - Intergenic
1021305491 7:19026489-19026511 CTAAAACTACACCAAAAAACTGG + Intronic
1021465740 7:20941624-20941646 CTCAAACTTTTCCAAAAAAATGG + Intergenic
1022305974 7:29146818-29146840 CAGAAATAATTTCAAAATACAGG - Intronic
1022323909 7:29312763-29312785 CTCAGACTATTCCCAAATAATGG + Intronic
1022702864 7:32777803-32777825 CTGAAAGTTTTCAATAATACTGG - Intergenic
1023359505 7:39400801-39400823 CTGAAACTATACCAAAATCATGG + Intronic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1025547525 7:62195962-62195984 CTGAAACTATTCCAATCAACAGG - Intergenic
1028013370 7:85677486-85677508 CTGAAACTATTCCAATCAATAGG - Intergenic
1028016565 7:85721568-85721590 CTGAAAATAAATCAAAATACTGG - Intergenic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1028306491 7:89271613-89271635 CTGAAACTATTCCAATCAATAGG - Intronic
1030245495 7:107380756-107380778 CCGAAACTATTCCAAACAATAGG + Intronic
1031005454 7:116465542-116465564 ATGAAACTATCCTAAAATAAGGG - Intronic
1031181800 7:118428473-118428495 CTGAAAGTATTCAAAAATGTGGG - Intergenic
1031420363 7:121544291-121544313 AGGAAACTAGTCCAAAATAATGG - Intergenic
1031658130 7:124384070-124384092 CTGAAACTGTTCTGAAAAACAGG + Intergenic
1031751927 7:125585859-125585881 CTGAAAATTTCCCAAAATAATGG - Intergenic
1032204925 7:129854477-129854499 CTGAACATGTTCCATAATACAGG - Intronic
1032272887 7:130427621-130427643 CTTAAGGTATTCCAAAATAGAGG + Intronic
1032779640 7:135153882-135153904 CTGAAACTATTAAAAAATCAAGG - Intronic
1032966682 7:137105776-137105798 CTGAAACTATTGCAAACAACAGG + Intergenic
1033525957 7:142213770-142213792 CTGAAACTATTCCAAACAAGAGG + Intronic
1033726169 7:144120758-144120780 CTGAAACTATTCCAATCAATAGG + Intergenic
1034320585 7:150177002-150177024 CTGAAACTATGTTAAAATATAGG - Intergenic
1034656306 7:152732000-152732022 CTGTATCAATTTCAAAATACGGG + Intergenic
1035554845 8:559341-559363 CTGAAACTATTCCAAACAATTGG + Intergenic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1037055623 8:14436988-14437010 ATGAATCTATTTCAAAATTCTGG - Intronic
1037296964 8:17412214-17412236 CAGGAACTATTCCAAAATTTAGG + Intronic
1037428071 8:18778997-18779019 CTCAAACTATTCCGAAAAATTGG - Intronic
1037939012 8:22936553-22936575 CTCAAACTCTTCCAAAACATTGG + Intronic
1038090779 8:24250629-24250651 CTAGAACTCTTCAAAAATACAGG - Intergenic
1038654169 8:29433528-29433550 TTGAAACCAGTCCAAAATATTGG + Intergenic
1039289587 8:36079477-36079499 CTGAAACTACTCCAAAAAATTGG + Intergenic
1039678724 8:39704157-39704179 CTGAAACTATTCCATAAAATTGG + Intronic
1039851450 8:41369072-41369094 AGGAAACAATTCCAAAATCCAGG + Intergenic
1041150598 8:54929028-54929050 TTGACACTATTCCAAAAGATAGG + Intergenic
1041346898 8:56908942-56908964 CTGAATGTATTCTAAAATAATGG - Intergenic
1041630241 8:60079436-60079458 CTGAAACTATTCCAAACAATAGG - Intergenic
1041771498 8:61477343-61477365 CTGAAACTATTCCAATCAATAGG - Intronic
1041885611 8:62804210-62804232 CTGAAACTATTCCAATCAATAGG + Intronic
1041886489 8:62815317-62815339 CTGAAACTATTCCAATCAATAGG + Intronic
1042038361 8:64563340-64563362 CTGAAACTATTCCAAACAATAGG - Intergenic
1042070480 8:64927985-64928007 CTGAAACTATTCCAAACAATTGG - Intergenic
1042675258 8:71313441-71313463 CTGGAACTATTCCAGAAAGCTGG + Intronic
1042687202 8:71455355-71455377 CTGAAACTATTCCAATCAATAGG + Intronic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1044007064 8:86950686-86950708 CTCAAACTATTCTGAAAAACAGG - Intronic
1044877016 8:96679466-96679488 CTCAAACTATTCAAAAAAATTGG - Intronic
1045072136 8:98518782-98518804 CTGCAACTATTTCAAAGTGCAGG + Intronic
1046047637 8:108983158-108983180 CTGAAACTATTCCAATCAATAGG - Intergenic
1046799084 8:118405124-118405146 CTGGAACTATCCTACAATACTGG + Intronic
1046992783 8:120478735-120478757 GTGAAAGTATTTCAAAATAGTGG + Intronic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1048626637 8:136192744-136192766 CTGAAACTATTCCAATCAATAGG - Intergenic
1048713768 8:137243961-137243983 CTGAAACTATTCCAATCAATAGG + Intergenic
1050141236 9:2518135-2518157 CTGAAACTATTCCAAACAATAGG - Intergenic
1050491333 9:6191206-6191228 ATGAAAATATTCCAATATTCTGG - Intergenic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1050638540 9:7640353-7640375 CTGACCCTATGCCAAAATCCTGG - Intergenic
1050927691 9:11286466-11286488 CTGAAACTATTCCAATCAATAGG + Intergenic
1051239838 9:15042324-15042346 CTGAAAGTATGCTAAAAGACAGG + Intergenic
1051793874 9:20841270-20841292 CTTAAACTATTACAAAAAATAGG - Intronic
1051834012 9:21314303-21314325 ATGAAACTATTACACAATATTGG + Intergenic
1051998721 9:23250364-23250386 CTGAAACAATTCCAAACAATAGG + Intergenic
1052061211 9:23963245-23963267 CTGAAACTATTCCAAACAGTGGG - Intergenic
1052094319 9:24366120-24366142 CTGAAACTATTTCAAAAAACTGG - Intergenic
1052576308 9:30296180-30296202 CTGAAAATATTCAAGAATTCTGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1052696508 9:31885702-31885724 TTGAAACTATTCCAAATAATAGG - Intergenic
1053015531 9:34659956-34659978 CTGAACCAGTTCCAAAAGACAGG + Intronic
1053473956 9:38368252-38368274 TTGAAACTAAACCAAAATATGGG - Intergenic
1053618347 9:39792304-39792326 CTTAACCTCTTCCCAAATACTGG + Intergenic
1053876525 9:42551662-42551684 CTTAACCTCTTCCCAAATACTGG + Intergenic
1053896150 9:42743041-42743063 CTTAACCTCTTCCCAAATACTGG - Intergenic
1054235173 9:62550059-62550081 CTTAACCTCTTCCCAAATACTGG - Intergenic
1054265808 9:62915125-62915147 CTTAACCTCTTCCCAAATACTGG - Intergenic
1054756648 9:68965627-68965649 CTTAAACCATCCAAAAATACAGG + Intronic
1055014321 9:71599423-71599445 CTGAAACTATTCCAATCAATAGG + Intergenic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1055819438 9:80244134-80244156 CTGAAAATGTTACAAAATGCAGG + Intergenic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1056130565 9:83582522-83582544 TTGAAATTATTCCAATATAATGG - Intergenic
1057129889 9:92647359-92647381 CTGAAACTCCTTCAAAAAACTGG + Intronic
1059560147 9:115326563-115326585 CTGAAAATTTGCCAAAGTACTGG + Intronic
1061456758 9:130703991-130704013 CTGAAACTATTCCCTAATACCGG - Exonic
1186625650 X:11290605-11290627 TTGAAATTATTCCAGAATATTGG + Intronic
1186683422 X:11899789-11899811 CTGAATGTAATACAAAATACTGG + Intergenic
1187041793 X:15604085-15604107 CTGAAACAATTACACAGTACAGG + Intergenic
1188142767 X:26572706-26572728 CTGAAACTACGGCAAAAGACAGG - Intergenic
1188560900 X:31467709-31467731 CTGAAACTATTCTAAACAATAGG - Intronic
1188566999 X:31537893-31537915 CTGAAAGTATTTCAAATTTCAGG + Intronic
1188725213 X:33574460-33574482 CTGAAACTATTACAAAAAATTGG - Intergenic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1190800804 X:53786933-53786955 CTGAAACTATTCCAATCAATAGG + Intergenic
1191132981 X:57034599-57034621 CTGAAACTATCCCAAACAATAGG - Intergenic
1191196380 X:57728025-57728047 CTGAAACTATTCCAATCAATAGG - Intergenic
1191749340 X:64524572-64524594 CTGAAACTACTCCAAAAATTTGG + Intergenic
1192133894 X:68578816-68578838 CTGAAACTATTCCAATCAACAGG - Intergenic
1192293158 X:69818814-69818836 CTGAAACTATTCTAAACAATTGG + Intronic
1192857919 X:75033776-75033798 CTGAAACTATTCCAAACAATAGG - Intergenic
1193001079 X:76563139-76563161 CTGAAACTATTCCAATCAATAGG + Intergenic
1193011892 X:76685876-76685898 CTGAAATCATTCCAAAAAATGGG - Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193230817 X:79043993-79044015 CAGAAACTTTTCCAAACTATTGG - Intergenic
1193252112 X:79303365-79303387 CTAAAACCATTCCAAAAAAGTGG + Intergenic
1193354643 X:80503824-80503846 CTGAAACTATTTGAAAAGATTGG + Intergenic
1193513792 X:82437773-82437795 CTGAAACTATTTCAAAAGACAGG + Intergenic
1193583999 X:83298380-83298402 CTGAAAGTATTCCAAAACAGAGG + Intergenic
1193661539 X:84264368-84264390 CTGAAACTATTCCAATCAATAGG - Intergenic
1193908948 X:87278905-87278927 CTGAAACTATTCCAATCAATAGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1194203862 X:90987095-90987117 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1194437475 X:93885698-93885720 CTGAAACTATTCCAATCAATAGG - Intergenic
1194438827 X:93903512-93903534 CTGAAATTATTGCAAAAGACAGG - Intergenic
1194439083 X:93907157-93907179 CTCAAACTATTCTAAAAAATAGG - Intergenic
1195586432 X:106570385-106570407 CTGAAACTATTCCAAGAAATTGG + Intergenic
1195601620 X:106755355-106755377 CTGAAACTATTCTGAAAAAACGG + Intronic
1195629509 X:107040182-107040204 CTCAAACATTTCCAAAATATTGG + Intergenic
1196471857 X:116037399-116037421 CTGCTACGATTCCAAAAAACTGG + Intergenic
1196615173 X:117759724-117759746 CTGAAACTATTCCAATCAATAGG - Intergenic
1196981872 X:121223248-121223270 CTGAGACAATTCCAACATAATGG - Intergenic
1197112026 X:122787517-122787539 CACATACCATTCCAAAATACTGG - Intergenic
1197189277 X:123627616-123627638 CTAAAACAATTTCAAAATATAGG + Intronic
1197312524 X:124923330-124923352 ATGAAACTGTTTCAAAATAAAGG - Intronic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197376113 X:125683690-125683712 CTAAAACTAGTATAAAATACTGG + Intergenic
1198579909 X:138051926-138051948 CTGAAACTATTTGAAAAAATTGG + Intergenic
1199359046 X:146896134-146896156 CAGAAACTATGACATAATACAGG + Intergenic
1199841865 X:151657403-151657425 CTGAAACTATTCCAATCAATAGG - Intronic
1200549699 Y:4562544-4562566 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1200679793 Y:6196561-6196583 CTGAGACTATGACCAAATACTGG - Intergenic
1201974747 Y:19836646-19836668 CTGAAACTATTCCAATCAATAGG - Intergenic
1202044159 Y:20720837-20720859 CTGAAACTATTCCAATCAACAGG + Intergenic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic