ID: 912630578

View in Genome Browser
Species Human (GRCh38)
Location 1:111243288-111243310
Sequence TGGGATTCCCCTTGCCAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912630572_912630578 3 Left 912630572 1:111243262-111243284 CCTGCTCTCTCCCAGGAATTCTC 0: 1
1: 0
2: 2
3: 31
4: 324
Right 912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 187
912630569_912630578 18 Left 912630569 1:111243247-111243269 CCTTGCTGCCTGGGGCCTGCTCT 0: 1
1: 0
2: 10
3: 63
4: 528
Right 912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 187
912630575_912630578 -7 Left 912630575 1:111243272-111243294 CCCAGGAATTCTCATGTGGGATT 0: 1
1: 0
2: 0
3: 18
4: 220
Right 912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 187
912630576_912630578 -8 Left 912630576 1:111243273-111243295 CCAGGAATTCTCATGTGGGATTC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 187
912630570_912630578 10 Left 912630570 1:111243255-111243277 CCTGGGGCCTGCTCTCTCCCAGG 0: 1
1: 0
2: 9
3: 71
4: 644
Right 912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912630578 Original CRISPR TGGGATTCCCCTTGCCAGGC TGG Exonic
900117620 1:1035188-1035210 AGGGGTGCCCCTTTCCAGGCTGG + Intronic
900286205 1:1901777-1901799 TGGGCTGCCCCTTACCTGGCAGG - Intergenic
901208286 1:7509824-7509846 GGGGCCTCCCCTTGCCAGCCAGG + Intronic
903646342 1:24898366-24898388 TGAGTTTCCCCTTGGCAAGCTGG + Intergenic
903669484 1:25027090-25027112 TGGGATTCCCCTCGCCTGATCGG - Intergenic
904816043 1:33199820-33199842 GGGGTTTCCCCATGCCAGGATGG - Intergenic
904904744 1:33886716-33886738 AGGGTTTCCCCTTGGCAGACAGG + Intronic
906218616 1:44059835-44059857 TGGGATTCCACTTGTCAGTGAGG + Intergenic
908664717 1:66477337-66477359 AGGGTTTCGCCATGCCAGGCTGG - Intergenic
912111097 1:106344654-106344676 TGGGATTCAAACTGCCAGGCAGG - Intergenic
912630578 1:111243288-111243310 TGGGATTCCCCTTGCCAGGCTGG + Exonic
915534783 1:156528814-156528836 TGAGATTCCCCTTTCAAAGCTGG + Intronic
915728047 1:158032736-158032758 GGGGATTCCCCATCACAGGCTGG - Intronic
916488122 1:165277390-165277412 TGGAATTCCCCTTCCCAAGGGGG - Intronic
918430058 1:184450215-184450237 TGGGATTCTCCATGTCAGGGAGG + Intronic
919258539 1:195158217-195158239 TGGTATTCCAATTCCCAGGCAGG - Intergenic
920419032 1:205817744-205817766 TGGGATTCCCTTAGGCAGGATGG + Intergenic
922504831 1:226120503-226120525 TGGGAGTCCCCAAGCCAGGTGGG + Intergenic
922528730 1:226326720-226326742 TGGGATACTCCTTGCCAGCCAGG - Intergenic
922548076 1:226473490-226473512 TGCCACTCTCCTTGCCAGGCTGG + Intergenic
923512640 1:234665749-234665771 TGGGTTACTCCTTGCCTGGCTGG - Intergenic
924081239 1:240400537-240400559 TGGGCTTCCACCTGCCCGGCTGG + Intronic
1063715221 10:8520329-8520351 AGGGATTCCCATTCCCAGGCCGG + Intergenic
1065395961 10:25238176-25238198 TGGGAGTCCACTTCACAGGCAGG + Intronic
1067726246 10:48773450-48773472 TGGAATTATCCTTCCCAGGCTGG - Intronic
1072577879 10:96717064-96717086 AGGGTTTCACCATGCCAGGCTGG - Intronic
1072735445 10:97875971-97875993 CGAGAGTCCCCTCGCCAGGCGGG - Intronic
1072892829 10:99340222-99340244 TGGCATTTCTTTTGCCAGGCTGG - Intronic
1073179548 10:101575393-101575415 TGGGATGCCTCTTGCCAGGATGG - Intronic
1073782857 10:106858424-106858446 GGGGTTTCCCCTTGTCAGCCAGG - Intronic
1076479501 10:130775597-130775619 TGGAAGTCTCCTGGCCAGGCAGG + Intergenic
1077371265 11:2182672-2182694 TGGTTCCCCCCTTGCCAGGCAGG + Intergenic
1078836985 11:15040372-15040394 TCAGATTGCCTTTGCCAGGCTGG - Intronic
1079568284 11:21910414-21910436 GGGGTTTCACCATGCCAGGCTGG + Intergenic
1080377088 11:31725298-31725320 ATGGATTCCCCTTGCCAGGCAGG + Intronic
1080388400 11:31823664-31823686 TGGGAGGGCCCTTTCCAGGCAGG + Intronic
1081948550 11:47021511-47021533 AAGGACTCCCCCTGCCAGGCAGG - Intronic
1082014102 11:47471451-47471473 TTGGATTGGCCTTGCCTGGCTGG - Intronic
1083260092 11:61518171-61518193 TGGGCCTCTCCTGGCCAGGCCGG + Exonic
1086399836 11:86451510-86451532 TGGGCTTCCTCTTACCAAGCTGG + Intronic
1086506774 11:87513305-87513327 TGGGAAACACCCTGCCAGGCTGG + Intergenic
1087127232 11:94640091-94640113 TGGGATTCAGTTCGCCAGGCAGG + Intergenic
1090080962 11:123612421-123612443 AGAGCTTCCCCTTGCCTGGCAGG + Intronic
1090818110 11:130315844-130315866 TTGGCTTCCCCTGGCCAGGCGGG + Intergenic
1091194291 11:133718333-133718355 TGGGAATCCTCCTCCCAGGCCGG - Intergenic
1096229318 12:49888565-49888587 TTGGATTCCCCAGGGCAGGCTGG + Intronic
1096338206 12:50773869-50773891 TGTGAGTCACCATGCCAGGCCGG + Intronic
1097178345 12:57156505-57156527 TCCCATTCCCCTTGCCAGTCTGG + Intronic
1097680966 12:62648426-62648448 TGGGATGCCTCTTGGCAGGACGG - Exonic
1099150679 12:79109091-79109113 TGGGATTCAATCTGCCAGGCTGG - Intronic
1099661347 12:85567612-85567634 TTGCCTTCCCATTGCCAGGCAGG - Intergenic
1100977858 12:100141286-100141308 TGGGTTTCACCAGGCCAGGCTGG - Intronic
1101210972 12:102534843-102534865 TGGGAGGCCCCTTGCCCTGCTGG + Intergenic
1101913168 12:108876045-108876067 TGGGGTTCCCTTTGCCAAGAAGG - Intronic
1102939753 12:116928999-116929021 TGGGATTTCACTGGCCAGCCTGG + Intronic
1105409993 13:20163561-20163583 TGGGGTGCCCCCTGGCAGGCAGG + Intergenic
1105412437 13:20182373-20182395 GGGGATTCCCATTGCAGGGCAGG - Intergenic
1111599141 13:90449032-90449054 TGGGTTTCCCCATGTCAGCCAGG - Intergenic
1112179888 13:97068323-97068345 TGGGATTCCCCCTACCAGCGGGG + Intergenic
1112280275 13:98056739-98056761 TCGCACTCCCCTTTCCAGGCGGG - Intergenic
1113490943 13:110691295-110691317 TGTGAGTCACCGTGCCAGGCCGG + Intronic
1115546683 14:34470531-34470553 TGGGATTCCCCCTGCCTGCTAGG + Intergenic
1118128417 14:62935623-62935645 TGGGCTGCCGCTTGGCAGGCAGG - Intronic
1118285249 14:64465321-64465343 TGGGCTTCCCCGCGGCAGGCAGG + Intronic
1119110284 14:71966500-71966522 TGGGAGACCCCGTGCCAGGCTGG + Intronic
1119193800 14:72702367-72702389 TGGGGTTCCCAGAGCCAGGCAGG - Intronic
1119451688 14:74717324-74717346 TGGAGTTTCTCTTGCCAGGCTGG - Intronic
1119616410 14:76101817-76101839 TGGGATGCCTCTTGCCCTGCAGG + Intergenic
1121960653 14:98256367-98256389 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1122182641 14:99967188-99967210 CGGGATTCCGACTGCCAGGCCGG + Intergenic
1122470664 14:101963978-101964000 AGAGAGTCCCATTGCCAGGCTGG - Intergenic
1128128120 15:65207705-65207727 TGGGGTTCTTCTTCCCAGGCTGG + Exonic
1128291396 15:66481128-66481150 AGGGGTTCCCCTTGACTGGCAGG + Intronic
1129519301 15:76176047-76176069 TGGTATGCCCATTGCCACGCGGG + Intronic
1130633891 15:85598181-85598203 TTGGACTCCCCCTGCCATGCTGG + Intronic
1130857684 15:87855554-87855576 TGGGATTCCCAGTACGAGGCAGG + Intergenic
1130888695 15:88115262-88115284 TGGCATGCCCCTTGCAAAGCAGG + Intronic
1132424038 15:101698911-101698933 TGGGTTTCCACTTGACAGGCTGG - Intronic
1133913325 16:10085806-10085828 TGGGATCCCCCTGGCCAAGAAGG + Intronic
1134445345 16:14327069-14327091 TGGGGTTTCACTGGCCAGGCTGG + Intergenic
1136222621 16:28837865-28837887 TGGGAGTCCGCTTCCCAGGATGG + Intergenic
1138513822 16:57524923-57524945 TGTGGTTCCCCTTCCCAGCCCGG + Intronic
1139348804 16:66322593-66322615 TGGGTGTCCCCTTCCCAGGCTGG - Intergenic
1139529879 16:67537822-67537844 TGGGAATCCCCCTGCCTGGAGGG + Intronic
1142137181 16:88456805-88456827 TGGGAGTCCCCAGGTCAGGCTGG + Intronic
1142261866 16:89046681-89046703 TAGGTGTGCCCTTGCCAGGCAGG + Intergenic
1143885779 17:10063838-10063860 TGGGCTTCCCCTTGCACGGGTGG + Intronic
1145041124 17:19579366-19579388 TGCCCTTCCCCTTGCCAGGTAGG + Intergenic
1145285275 17:21501082-21501104 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1147749492 17:42720844-42720866 TGGGTTTCTCCATGTCAGGCTGG + Intronic
1149449427 17:56738220-56738242 TGGGGTGCCTCTTTCCAGGCTGG + Intergenic
1149475686 17:56959312-56959334 TGGGTTTCCCATGCCCAGGCTGG - Intronic
1151781403 17:76248552-76248574 TGGAATTCACCTTGGCAGACAGG - Intergenic
1151929408 17:77222142-77222164 GGGGTTTCACCTGGCCAGGCTGG - Intergenic
1152230272 17:79110844-79110866 TGAGATGCCCCTACCCAGGCTGG - Intronic
1152361036 17:79832982-79833004 AGGAATTCCCCTTCCCAGCCGGG + Intergenic
1152434327 17:80265976-80265998 TGGGAAGCCCATGGCCAGGCTGG + Intronic
1152555348 17:81050196-81050218 GGGGACTCCCCTTCCCGGGCGGG - Intronic
1155844125 18:30684341-30684363 TGGGATTCACTTGGCCAAGCGGG - Intergenic
1158603454 18:58874534-58874556 TGGGTTTCACCATGTCAGGCTGG + Intronic
1158711515 18:59842007-59842029 GGGGTTTCACCATGCCAGGCTGG + Intergenic
1160039238 18:75330827-75330849 TGGGATTCCACTTTCCAGTTAGG + Intergenic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1162111731 19:8403346-8403368 AGGGGTTCCCCTCGGCAGGCAGG + Intronic
1163700419 19:18784116-18784138 TGGGAGTGCCCTGGCCAGGCAGG - Intronic
1165453333 19:35897538-35897560 TACGATTCCCTTTTCCAGGCCGG - Intronic
1166095829 19:40538491-40538513 TGGGCTTCCCTTTGTCAGCCAGG + Intronic
1166864404 19:45827238-45827260 TGGGACTGCCCTTCCCAGGAGGG + Intronic
925601845 2:5616334-5616356 TGGGCATCCCCTGGCCAGTCAGG + Intergenic
925896330 2:8475049-8475071 TGGGATTCCCCATGGCAGCCAGG + Intergenic
926909004 2:17831908-17831930 TGGGTTTCCCCAGGCCATGCAGG - Intergenic
929142370 2:38677446-38677468 TGGGATTCTTCATGCCAGGGAGG + Intronic
929630540 2:43456468-43456490 TGGTATTCCTCTGGTCAGGCTGG - Intronic
929885097 2:45871213-45871235 TGAGACTCCCCTTGACAGGGTGG - Intronic
931797911 2:65729373-65729395 AGGGATGACCCTTGCAAGGCAGG - Intergenic
932722005 2:74145382-74145404 TGCCATTCCCCCTGCAAGGCAGG + Intronic
933700834 2:85254371-85254393 AGGGAGCCCCCTTGCCAGTCTGG - Intronic
933981757 2:87556236-87556258 TGTGAGTCCCCTTGCCAGGGAGG + Intergenic
935812979 2:106817840-106817862 TGGGATTCTCCTTTCAAGGCAGG - Intronic
936312079 2:111394581-111394603 TGTGAGTCCCCTTGCCAGGGAGG - Intergenic
938268544 2:129948121-129948143 TGGAATTCCCTTTGCCACCCTGG - Intergenic
946024229 2:216662139-216662161 TGGGATGCCAGCTGCCAGGCCGG + Intronic
948596901 2:239085407-239085429 TGGGCTTCCCCATGCCAGCCCGG - Intronic
1168776813 20:454865-454887 AGGGTTTCACCATGCCAGGCTGG + Intronic
1169033865 20:2433792-2433814 TGGGGTTCACCTGGCCAGGCAGG - Intergenic
1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG + Intronic
1171078310 20:22151655-22151677 TAGGATTCACCATCCCAGGCAGG + Intergenic
1171438430 20:25141690-25141712 TGGGCTCACCCTTGCCAGGCTGG + Intergenic
1172613565 20:36268481-36268503 TGGGGTTCTCTTTGCCAGTCTGG - Intronic
1175334586 20:58186964-58186986 TGGGATCTCCCTGGTCAGGCAGG + Intergenic
1175424650 20:58855682-58855704 CGGGACTCCCCTGGCTAGGCTGG + Intronic
1175430235 20:58896509-58896531 TTGCATTCCCCATGCCAGGCAGG - Intronic
1176058699 20:63162331-63162353 TGGGATTCCCCTTTTCAGGCCGG - Intergenic
1176109485 20:63404930-63404952 TGGGAGTGCCCTGGCCGGGCTGG + Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179481715 21:41682613-41682635 TGGGTGTGCCCGTGCCAGGCAGG - Intergenic
1179894587 21:44354263-44354285 TTGCAGTCCCCTTGCCAGGCAGG + Intronic
1180642150 22:17307628-17307650 TGGGATTTCACTTCCCAGACTGG - Intergenic
1182242424 22:28926610-28926632 TGGGGTTTCACTGGCCAGGCTGG - Intronic
1182619538 22:31611337-31611359 CTGGACACCCCTTGCCAGGCAGG - Intronic
1183912195 22:41088320-41088342 GGGGTTTCACCATGCCAGGCTGG - Intergenic
1184537382 22:45096361-45096383 GGTGATTCCTCATGCCAGGCTGG - Intergenic
949207284 3:1455199-1455221 TGGGATTCCCCATCCCTGGAAGG - Intergenic
950266547 3:11577399-11577421 GGGGTTTCACCATGCCAGGCTGG - Intronic
953378922 3:42452010-42452032 TGGGATTCAATCTGCCAGGCAGG - Intergenic
957541091 3:81570003-81570025 TAGGATTTAACTTGCCAGGCTGG + Intronic
965051909 3:163662221-163662243 TGGGATGCCCTGTGCCATGCTGG + Intergenic
968551054 4:1223536-1223558 AGGGACTCCCCTTGACCGGCCGG - Intronic
968910665 4:3475643-3475665 TGAGGTTCCCGTGGCCAGGCTGG + Intronic
968917595 4:3503367-3503389 TGGGAATACCCGTGCCAGGCAGG + Intergenic
968982876 4:3860139-3860161 AGGGCTTCCCCTCCCCAGGCAGG - Intergenic
969244736 4:5924976-5924998 TGGGAATTCCCTGGCCAGGAAGG + Intronic
969543722 4:7810480-7810502 TGGGCCTCCCCTTGCCAGCCAGG - Intronic
969984592 4:11194630-11194652 TGGAATTCCCACTGCCTGGCTGG - Intergenic
972100121 4:35405362-35405384 TGGGTTTCACCATGCCAGGCTGG - Intergenic
976826237 4:89263491-89263513 TGGGATTCAAATGGCCAGGCAGG + Intronic
977987368 4:103398988-103399010 TGGGATTCCCTTGGCCAAGAGGG + Intergenic
978137679 4:105282235-105282257 AGGGTTTCACCTAGCCAGGCTGG + Intergenic
979749388 4:124258701-124258723 TGGGATTCCCTTGTGCAGGCAGG + Intergenic
980198408 4:129621679-129621701 TGGGATTCCCAGCGCCTGGCCGG + Intergenic
980433086 4:132729027-132729049 TGGGTTTCACCTTGTTAGGCAGG + Intergenic
984287827 4:177756230-177756252 GGGGTTTCACCATGCCAGGCTGG - Intronic
985607926 5:868602-868624 AGGGCACCCCCTTGCCAGGCAGG - Intronic
988458883 5:31414156-31414178 TGGGATTCCCCTTCCCCTACAGG - Intronic
988899521 5:35717668-35717690 TGGGATTCAAACTGCCAGGCAGG - Intronic
990574383 5:57110408-57110430 AGGGTTTCACCTGGCCAGGCTGG - Intergenic
991969162 5:72122155-72122177 TGGGACTCTCCTTCCCAGGCAGG - Intronic
995393873 5:111666955-111666977 TGGGATTCAAATTGCCGGGCTGG - Intronic
996377068 5:122822280-122822302 GGGGTTTCACCTTGCCAGGATGG + Intronic
1000072761 5:157756164-157756186 TGAGAGTCCCCTTTCCAGGCAGG + Exonic
1001638537 5:173229667-173229689 AGGGACTGCCCTTGCCTGGCTGG - Intergenic
1003192885 6:3889773-3889795 TGGGATACCCCTGGCCAAGAGGG - Intergenic
1004404816 6:15323170-15323192 TGGGCTTTTGCTTGCCAGGCAGG + Intronic
1006303931 6:33207997-33208019 CGGGATTCCCCTTACCACCCTGG - Intergenic
1015078748 6:129196906-129196928 TGGGATTCCCTTGGCCAAGAAGG - Intronic
1015775172 6:136806597-136806619 GGGGTTTCACCATGCCAGGCTGG + Intergenic
1017343952 6:153357678-153357700 TGGGATTCCAACTGCGAGGCAGG + Intergenic
1018291426 6:162295841-162295863 GGAGATGCCCCTTGACAGGCAGG + Intronic
1018696915 6:166397667-166397689 TGACATCCCCCTTGCCAGTCAGG - Intergenic
1021597927 7:22336717-22336739 TGGGATTCAATCTGCCAGGCGGG + Intronic
1024655469 7:51448048-51448070 TGGGATTCGAATGGCCAGGCGGG + Intergenic
1028235904 7:88361352-88361374 TGGGATTCAACCTGCGAGGCGGG - Intergenic
1029536919 7:101162738-101162760 TGCGAGTTCCCTTGCCACGCGGG - Exonic
1030209989 7:106986649-106986671 TGGGCTTCCTCTTTGCAGGCAGG + Intergenic
1032025986 7:128443015-128443037 GGGGTTTCACCATGCCAGGCTGG - Intergenic
1032778097 7:135136551-135136573 TGGGATGCCCTCTGCCAGGTAGG + Intronic
1033012590 7:137638105-137638127 TGGGATTCCCTAGGGCAGGCAGG - Intronic
1034459365 7:151190044-151190066 TGGGTTTCCCCTTGCTGGGGAGG - Intergenic
1034947206 7:155270109-155270131 CAAGATTCACCTTGCCAGGCCGG + Intergenic
1037929188 8:22867545-22867567 TGGGTTCCCCCTTTCCATGCTGG + Intronic
1038208299 8:25490537-25490559 TGGGATTCCCATGAACAGGCCGG - Intronic
1038760449 8:30380997-30381019 GGGGTTTCACCATGCCAGGCTGG + Intergenic
1039381102 8:37086196-37086218 TGGACTTCCCCATTCCAGGCAGG + Intergenic
1040081719 8:43292214-43292236 TGGCATTCCCCTGGCTGGGCTGG + Intergenic
1040408523 8:47132881-47132903 TGGCATTCCCCTGGCTGGGCTGG - Intergenic
1041548254 8:59071174-59071196 TGAGATTCCACTTGCAAGGAGGG + Intronic
1043002794 8:74780043-74780065 TTGGAATCCCCTTGGCAGACAGG - Intronic
1048360020 8:133689658-133689680 TGGAATTCCCTTTTGCAGGCCGG + Intergenic
1055641396 9:78321250-78321272 TGGGATGACGCTTTCCAGGCAGG - Intronic
1057571752 9:96209342-96209364 AGAGAATCCACTTGCCAGGCTGG + Intergenic
1058958881 9:109974212-109974234 TGGCACTCACCCTGCCAGGCAGG - Intronic
1059384562 9:113954203-113954225 TGGGTTTCCCCTAGCCCAGCTGG + Intronic
1062102553 9:134736008-134736030 CGGGAGTCCCCTTGCCAGCCTGG + Intronic
1062123401 9:134846524-134846546 TGGGAGTCCCCTTGCATGACGGG - Intergenic
1062578821 9:137220944-137220966 TGGGGTGCCCCTTCCAAGGCAGG + Exonic
1186878306 X:13838908-13838930 TTGGAGTCCCCTTGGCAGGAGGG - Intronic
1187403012 X:18978942-18978964 GGGGTTTCACCATGCCAGGCTGG - Intronic
1190321974 X:49184935-49184957 GGGAATTCCCCTTCCTAGGCTGG + Intronic
1190913908 X:54795749-54795771 TGGGTTTCCTATTCCCAGGCTGG - Intronic
1197109687 X:122757507-122757529 TGGCATTTCCCTTGCTGGGCTGG - Intergenic
1197976469 X:132171223-132171245 TGGGATTGACCATGCCAGGGAGG + Intergenic
1201851543 Y:18488259-18488281 AGGGTTTCCCCTTGTCAGCCAGG + Intergenic
1201881777 Y:18832121-18832143 AGGGTTTCCCCTTGTCAGCCAGG - Intergenic