ID: 912633375

View in Genome Browser
Species Human (GRCh38)
Location 1:111268303-111268325
Sequence AGGAAGAACACAGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912633375_912633382 24 Left 912633375 1:111268303-111268325 CCTACAATCACTGTGTTCTTCCT No data
Right 912633382 1:111268350-111268372 CACCATGTAGCCACTGCCAGGGG No data
912633375_912633380 22 Left 912633375 1:111268303-111268325 CCTACAATCACTGTGTTCTTCCT No data
Right 912633380 1:111268348-111268370 CGCACCATGTAGCCACTGCCAGG No data
912633375_912633381 23 Left 912633375 1:111268303-111268325 CCTACAATCACTGTGTTCTTCCT No data
Right 912633381 1:111268349-111268371 GCACCATGTAGCCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912633375 Original CRISPR AGGAAGAACACAGTGATTGT AGG (reversed) Intergenic
No off target data available for this crispr