ID: 912639753

View in Genome Browser
Species Human (GRCh38)
Location 1:111333495-111333517
Sequence TTCCCAGCACATCTCCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912639750_912639753 15 Left 912639750 1:111333457-111333479 CCTTGTGCTCCTAATCTGGGGCA 0: 3
1: 8
2: 5
3: 31
4: 132
Right 912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG No data
912639752_912639753 6 Left 912639752 1:111333466-111333488 CCTAATCTGGGGCAATGCAGGTA No data
Right 912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912639753 Original CRISPR TTCCCAGCACATCTCCAAAC TGG Intergenic
No off target data available for this crispr