ID: 912643499

View in Genome Browser
Species Human (GRCh38)
Location 1:111369539-111369561
Sequence TAGGGTGAGGAGAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912643499_912643513 -2 Left 912643499 1:111369539-111369561 CCTGCCCCCTTCTCCTCACCCTA No data
Right 912643513 1:111369560-111369582 TAGGAGGAGGGGTGGAAGTATGG No data
912643499_912643510 -10 Left 912643499 1:111369539-111369561 CCTGCCCCCTTCTCCTCACCCTA No data
Right 912643510 1:111369552-111369574 CCTCACCCTAGGAGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912643499 Original CRISPR TAGGGTGAGGAGAAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr