ID: 912647373

View in Genome Browser
Species Human (GRCh38)
Location 1:111406648-111406670
Sequence GATCAACTTGAACCAGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912647373_912647375 -5 Left 912647373 1:111406648-111406670 CCAGATACTGGTTCAAGTTGATC No data
Right 912647375 1:111406666-111406688 TGATCCACCTGCACAAAAGGAGG No data
912647373_912647374 -8 Left 912647373 1:111406648-111406670 CCAGATACTGGTTCAAGTTGATC No data
Right 912647374 1:111406663-111406685 AGTTGATCCACCTGCACAAAAGG No data
912647373_912647378 12 Left 912647373 1:111406648-111406670 CCAGATACTGGTTCAAGTTGATC No data
Right 912647378 1:111406683-111406705 AGGAGGACACTGAACTGAGCAGG No data
912647373_912647379 21 Left 912647373 1:111406648-111406670 CCAGATACTGGTTCAAGTTGATC No data
Right 912647379 1:111406692-111406714 CTGAACTGAGCAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912647373 Original CRISPR GATCAACTTGAACCAGTATC TGG (reversed) Intergenic
No off target data available for this crispr