ID: 912647375

View in Genome Browser
Species Human (GRCh38)
Location 1:111406666-111406688
Sequence TGATCCACCTGCACAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912647371_912647375 11 Left 912647371 1:111406632-111406654 CCACATCACACAGGGACCAGATA No data
Right 912647375 1:111406666-111406688 TGATCCACCTGCACAAAAGGAGG No data
912647373_912647375 -5 Left 912647373 1:111406648-111406670 CCAGATACTGGTTCAAGTTGATC No data
Right 912647375 1:111406666-111406688 TGATCCACCTGCACAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912647375 Original CRISPR TGATCCACCTGCACAAAAGG AGG Intergenic
No off target data available for this crispr