ID: 912649014

View in Genome Browser
Species Human (GRCh38)
Location 1:111421782-111421804
Sequence CCCCACAGGCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912649014_912649026 23 Left 912649014 1:111421782-111421804 CCCTGCTCCTTCTGCCTGTGGGG 0: 1
1: 0
2: 2
3: 46
4: 408
Right 912649026 1:111421828-111421850 CTGCCACTGGAACAAACAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 198
912649014_912649028 28 Left 912649014 1:111421782-111421804 CCCTGCTCCTTCTGCCTGTGGGG 0: 1
1: 0
2: 2
3: 46
4: 408
Right 912649028 1:111421833-111421855 ACTGGAACAAACAGCTGGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 120
912649014_912649023 10 Left 912649014 1:111421782-111421804 CCCTGCTCCTTCTGCCTGTGGGG 0: 1
1: 0
2: 2
3: 46
4: 408
Right 912649023 1:111421815-111421837 CTGTGCTATCCACCTGCCACTGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912649014 Original CRISPR CCCCACAGGCAGAAGGAGCA GGG (reversed) Intronic
900115681 1:1026866-1026888 CCCAGCAGGCAGGAGGTGCAGGG - Intronic
900340868 1:2188491-2188513 CCCCCACGGTAGAAGGAGCAAGG + Intronic
900428123 1:2589723-2589745 CCCCACAGGCCAAAGGCCCAAGG - Exonic
901812621 1:11776523-11776545 GCCCAGGGGCAGCAGGAGCAAGG + Exonic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902546062 1:17190993-17191015 ACCTACAGGCAGAAGGTTCAAGG + Intergenic
902656857 1:17875047-17875069 CCCCACAGCCAGCAGGAGGAAGG - Intergenic
903394100 1:22986066-22986088 GCCCACTGGCAGAAGAAGCAGGG + Intergenic
903559810 1:24218770-24218792 TTCCACAGCCAGCAGGAGCAGGG - Intergenic
903619981 1:24691029-24691051 TTCCACAGGCAGCAGGAGCATGG - Intergenic
903800407 1:25963068-25963090 GCCCTCAGGCTGAGGGAGCAGGG + Intronic
904305421 1:29585651-29585673 CCCCACAGGGCTGAGGAGCAAGG + Intergenic
904324622 1:29720278-29720300 GCCCAGAGGCAGCAGGTGCAGGG - Intergenic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905799140 1:40832278-40832300 CAGCACAGGCAGAAACAGCATGG - Intronic
905889254 1:41509491-41509513 CCACAAAGGCAGAAGTGGCAGGG - Exonic
906156147 1:43615213-43615235 CCCTATAGGCAGAGGCAGCACGG - Intronic
906323995 1:44832985-44833007 CCACTCAGGCAGAAAGTGCATGG + Intronic
908945376 1:69489789-69489811 CCCCAGAGGCAGAAAAAGCATGG + Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909909731 1:81246286-81246308 CCGCAAAGGGTGAAGGAGCAGGG - Intergenic
910414197 1:86981198-86981220 CCCCACATGTTGAGGGAGCAAGG - Intronic
912382252 1:109253970-109253992 CCCTCCAGGCAGAAAGAGCCTGG + Intronic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913319796 1:117580203-117580225 TCCCCCAGGCTGGAGGAGCAGGG - Intergenic
914847244 1:151289981-151290003 GCCCACATGAAGAAGGAGCATGG + Exonic
915979416 1:160410726-160410748 GGCAACAGGCAGAGGGAGCAGGG - Intronic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916491702 1:165307755-165307777 GACCACAGGTAGAAGGACCAAGG + Intronic
916749951 1:167714564-167714586 CCCCACAGCGTGGAGGAGCAGGG - Intergenic
917542161 1:175924797-175924819 CCCCACAGACAGAAGGAGACAGG - Intergenic
917965514 1:180176136-180176158 CCCCACAGGCAAAGGCAGCAAGG - Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920945907 1:210528291-210528313 CCCCTGTGGTAGAAGGAGCAGGG + Intronic
922179670 1:223223909-223223931 GCCCACAGGTCAAAGGAGCAAGG - Intronic
924945942 1:248847044-248847066 CCCCACAGGCTCACGGTGCAGGG + Exonic
1064417222 10:15160350-15160372 ACACACAGGCACAAGGAGCCCGG + Intronic
1066088925 10:31998491-31998513 CCCCACAGGAAAATGGACCAAGG - Intergenic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1068247367 10:54390366-54390388 CCCCAGAGGCAGAGGTTGCAGGG - Intronic
1069819951 10:71221277-71221299 CCCCACTGGCAGAGGCAGCCTGG + Intronic
1069829150 10:71271992-71272014 CCCCACAGCCGCAAGGAGCCAGG + Intronic
1070159996 10:73860552-73860574 GCCCAAAGACAGAAGGAGAAAGG + Intronic
1070736162 10:78865228-78865250 CCCCAAAGGGAGCAGGGGCAGGG - Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072709030 10:97703640-97703662 GCCAGGAGGCAGAAGGAGCAAGG + Intergenic
1074555061 10:114481286-114481308 CCCCCCATTCAGCAGGAGCAGGG + Intronic
1075216297 10:120539179-120539201 CCCCACAAGCACAGGCAGCATGG - Intronic
1075551648 10:123397110-123397132 AACCACAGTCAGAAGGAGAAGGG - Intergenic
1075761662 10:124862212-124862234 CCACACTGGGAGCAGGAGCAGGG + Intergenic
1076547526 10:131255184-131255206 CCCCACTGGCAGAGGGGACAAGG + Intronic
1076559918 10:131355435-131355457 TCCAAATGGCAGAAGGAGCATGG - Intergenic
1076916603 10:133425582-133425604 CCCATCAGGCAGAAGGAGCTTGG + Intergenic
1076922601 10:133462570-133462592 TGCCACAGGCAGCAGCAGCAAGG + Intergenic
1076936707 10:133570377-133570399 CCCATCAGGCAGAAGGAGCTTGG + Intergenic
1077020750 11:416202-416224 CCCCGCAGGAAGCAGGAGCAGGG + Intronic
1077317375 11:1925491-1925513 CCCCCCAGGCAGTAGGGCCAGGG + Intronic
1077505468 11:2928115-2928137 CACCACAGGCAGCAGCAGCTCGG + Intergenic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078901143 11:15643961-15643983 CCCCACAGAAACAAGGATCAAGG - Intergenic
1079008780 11:16811546-16811568 CCCCACAGGCTGCAGGAGGATGG + Intronic
1079106959 11:17577970-17577992 CCCCAGAGGGACCAGGAGCAGGG - Intronic
1080746280 11:35111389-35111411 CCCCACAGGAATCAAGAGCAAGG - Intergenic
1083766287 11:64843089-64843111 GCCCACAGGCAGGAGGATCCAGG + Intronic
1083796725 11:65021270-65021292 CACCACAGTGAGAAAGAGCAGGG + Intronic
1084459897 11:69290902-69290924 GCTCACAGGCAGAAGGGTCAGGG + Intergenic
1084485049 11:69443365-69443387 CCCCCGAGGGAGGAGGAGCAGGG - Intergenic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1085450098 11:76626685-76626707 CCCCACAGGGAGAGGGATTAAGG + Intergenic
1086930995 11:92692935-92692957 ACCCACAGGCAGAAAAATCAGGG + Intronic
1086963348 11:93002757-93002779 CACCACAGGCAGAACAAGCCTGG + Intergenic
1087977309 11:104565328-104565350 CCCCGCAAGCAGAGGGAGCCGGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088999798 11:115042293-115042315 CCCCACAGTCACCAAGAGCAAGG + Intergenic
1089186463 11:116618790-116618812 CCCCTCAGGCAGCATGAGCAGGG + Intergenic
1089340564 11:117754581-117754603 CACCACCAGCAGAAGAAGCAAGG + Intronic
1089359946 11:117879103-117879125 GCCCTGAGGCAGAAGGGGCATGG + Intergenic
1090269855 11:125378470-125378492 CCCCATTGGAAGAAGCAGCAGGG + Intronic
1090275788 11:125418496-125418518 CCCCCCAGCCAGAAGGAGCCCGG - Intronic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1090716203 11:129433601-129433623 CCCTAAAGGCCGAATGAGCATGG - Intronic
1091581585 12:1793688-1793710 ACACACAGGCAGCAGGAGTAGGG + Exonic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1091991748 12:4961167-4961189 CCAGACAGGCAGCAGGAGCATGG + Intergenic
1092103919 12:5907536-5907558 CCCCAAAGGGAGAAGGTGCAGGG - Intronic
1092504112 12:9077744-9077766 TCCCAGAGGCAGAAGGACAATGG - Exonic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092826452 12:12404417-12404439 CTCAACTGGCAGAAGGAGAATGG + Intronic
1092964395 12:13627612-13627634 CTCCAAAGGAAGAAGCAGCAGGG + Intronic
1093878961 12:24382298-24382320 CACCACAGGCTGAAGGAACCTGG + Intergenic
1096086449 12:48868316-48868338 CACCACAGGCAGTAGGAGAGTGG + Intergenic
1096583967 12:52607500-52607522 CTCCACAGGCAGAAGACACATGG + Intergenic
1096718773 12:53506185-53506207 GCCCAGAGGCAGAAAGAGCAGGG - Exonic
1097042750 12:56165453-56165475 CCCCACTGCCAGCAGGAGCAGGG + Exonic
1097337949 12:58405821-58405843 CCCCACAGGCAGAACAAGTCTGG - Intergenic
1099721806 12:86371614-86371636 TCCCATAGGCAGAAGTAGCTAGG + Intronic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101210090 12:102526720-102526742 CCCCACAGGGAGAAAAAGAAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101604753 12:106239661-106239683 TCCCACGGGCCGAAGGAGGACGG - Exonic
1102435488 12:112919513-112919535 CCCCACAGGCAGAAGAGGACTGG + Exonic
1102508280 12:113397654-113397676 GCCCCCTGGGAGAAGGAGCAGGG - Intronic
1102767701 12:115448094-115448116 CCCCAGAAGCCGGAGGAGCAAGG + Intergenic
1103914660 12:124370061-124370083 CCCCACAGCCAGCAGGAGCGGGG + Intronic
1104324715 12:127785356-127785378 CCCTACTCCCAGAAGGAGCATGG + Intergenic
1104448669 12:128853000-128853022 TCCCACAGGGAACAGGAGCAGGG - Intergenic
1104475115 12:129064668-129064690 CGCCACGAGCACAAGGAGCAAGG + Intergenic
1104502858 12:129302963-129302985 CTCCAAAGGCAGAAGAACCAAGG + Intronic
1104635527 12:130435997-130436019 CCCCACAGGCTGACCCAGCAGGG + Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1112494754 13:99895996-99896018 CCCCGCGGGCAGGAGGAGCGCGG + Exonic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113220228 13:108092465-108092487 CCGCAGTGGCAGAAAGAGCAAGG - Intergenic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1113803274 13:113097138-113097160 GTCCAGAGGCAGAAGCAGCACGG - Intronic
1114263631 14:21057921-21057943 CCCCAGAAGCAGCAGCAGCAGGG - Exonic
1118866830 14:69711021-69711043 TCCCACAGGGAGAGGGAGGAAGG - Exonic
1119171936 14:72542214-72542236 CCCCAAGAGCAGGAGGAGCATGG - Intronic
1119211480 14:72835531-72835553 ACCCACAGCCACAAGGAGCTGGG + Intronic
1119229558 14:72969522-72969544 CCCAGGAGGCAGGAGGAGCAGGG + Exonic
1119519079 14:75272290-75272312 GCCCAGAGGCAGAAGCAGCTTGG + Intergenic
1119861813 14:77941429-77941451 CCCTACAGGAAGAAAGAGCAAGG - Intergenic
1120479260 14:85028293-85028315 CCCCACTGGTAGAAGGATTAGGG - Intergenic
1120850380 14:89164154-89164176 CCTCCCAGACATAAGGAGCATGG - Intronic
1122102014 14:99420245-99420267 CCCCACAGGCAGGCTCAGCAAGG + Intronic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122504362 14:102222262-102222284 CCCCACAGGTAGAGACAGCAGGG - Intronic
1122774678 14:104111912-104111934 CCCCATAGGCAGAGGCAGCCGGG + Exonic
1122842576 14:104473547-104473569 CCCCTCAGCCAGAAAGAGCCAGG - Intergenic
1122896696 14:104761093-104761115 CTCCCCAGGCAGAAGGAGCGAGG - Intronic
1122925806 14:104899246-104899268 CCCCACTGGCTGAGGGAGAAAGG + Intergenic
1124237688 15:28004060-28004082 ACCCACAGGAAGGAAGAGCAGGG - Intronic
1125560906 15:40632524-40632546 CCCAACAGGCAGAACTTGCAAGG + Intronic
1125609525 15:40961071-40961093 CTCCACAGGCAGCAAGAGGAAGG - Intergenic
1127214409 15:56809570-56809592 AATCACAGGCAGAAGGACCAAGG - Intronic
1127476481 15:59338673-59338695 TCCCACAGGCAGGAGGAGCAAGG + Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129444570 15:75607952-75607974 CCCCAGAGGCAGAATGAACTGGG + Intronic
1129460080 15:75696184-75696206 CCCCACAGTCAGGAGGGGGAAGG - Intronic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129925471 15:79359856-79359878 ACCCACGGGCAGAAGAAGAAGGG - Intronic
1129968447 15:79757181-79757203 CCCAGGAGGCAGAAGGAGCAGGG + Intergenic
1132346353 15:101111402-101111424 CCCCAAGGGAAGGAGGAGCAGGG - Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132951761 16:2566794-2566816 CAACACAGGCAGGAGGAGCCAGG - Intronic
1132962589 16:2633376-2633398 CAACACAGGCAGGAGGAGCCAGG + Intergenic
1133290625 16:4718453-4718475 CCCCACTGGCAGAAGGGAAATGG + Intronic
1134043233 16:11083764-11083786 CGCCACAGGCAGCAGGAGGCTGG - Intronic
1134242824 16:12518382-12518404 ACCCCCAGGCAGAAGGAGCTTGG - Intronic
1134400346 16:13904180-13904202 CCCCACGGGTAGAAGGAGGGAGG - Intergenic
1134626987 16:15729269-15729291 CCCCACAAGCAGATGGAACCAGG + Intronic
1135328148 16:21540777-21540799 CCACAGAGACAGAAGCAGCACGG - Intergenic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136172807 16:28498574-28498596 CCACAGTGGCAGAGGGAGCAGGG - Exonic
1136338501 16:29626797-29626819 CCACAGAGACAGAAGCAGCACGG - Intergenic
1137376235 16:47954367-47954389 ACCCACATGCAGTAAGAGCAAGG + Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137546901 16:49411008-49411030 CCCCACAGGCAGGTGGGGCTTGG - Intergenic
1137565752 16:49531560-49531582 ACCCCCAGGCAGAAAGAGGAGGG + Intronic
1137602212 16:49764007-49764029 CCCCACGGGCAGGAGGAGACAGG + Intronic
1138315479 16:56066035-56066057 CCCTAAAAGCAGCAGGAGCATGG + Intergenic
1138374089 16:56550716-56550738 CCCCACAGGAAGCAGGAAGATGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1141678500 16:85530309-85530331 AGCCAGAGGCAGAGGGAGCAAGG + Intergenic
1142041238 16:87895711-87895733 CCACAGAGACAGAAGCAGCAGGG - Intronic
1142189547 16:88711614-88711636 CCCTAGAGGGAGAAGCAGCAGGG - Exonic
1143579818 17:7818886-7818908 GCCCAGAGGCACATGGAGCAAGG - Intronic
1144863027 17:18317641-18317663 CGCCACAGGCAGAAGGACCAGGG + Exonic
1145251110 17:21297537-21297559 TTCCACAGGCAGGAGAAGCAAGG - Intronic
1145773777 17:27512132-27512154 CACTACAGGGAGAAAGAGCAGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145978183 17:28996362-28996384 CCCCTCAGGCAAAAGGTGCCTGG - Intronic
1146915657 17:36676758-36676780 CCCCACTGGGAGAAGGTGCCTGG - Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1152154265 17:78622660-78622682 CCCCACAGGAAGGGAGAGCACGG + Intergenic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1152647315 17:81475393-81475415 ACACACAGGGAGAAAGAGCAAGG + Intergenic
1152768477 17:82153491-82153513 CCCCACAGGCAAAGGAAGGAGGG + Intronic
1152790166 17:82274373-82274395 CCCCCCAGGCTGCAGGTGCATGG + Intergenic
1152851666 17:82640071-82640093 CCCCCAAGACTGAAGGAGCAGGG + Intronic
1152894230 17:82901483-82901505 CTCCCCAGGCAGCAGGACCACGG - Intronic
1152894278 17:82901654-82901676 CTCCCCAGGCAGCAGGACCACGG - Intronic
1153882741 18:9434890-9434912 CCCCAGAGGCAGAGGTTGCAGGG + Intergenic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1154145637 18:11864160-11864182 CCCAAGAGGCAGAAGTTGCAGGG - Intronic
1155022856 18:21912517-21912539 CCCCACAGGCTGCAGCAGCCAGG - Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1155911682 18:31511374-31511396 CCCCAGTGGCAGGAGGAGCGGGG + Intronic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1157796513 18:50580133-50580155 CCCCACAGACTGAAGGAGGAAGG - Intronic
1157890088 18:51407234-51407256 CCCAACAGGGAGAAGGAATATGG - Intergenic
1159898911 18:74023603-74023625 CACCACTGGCAGAAGGTGAAGGG - Intergenic
1160397565 18:78583499-78583521 CCCCACAGGCCTCAGGAGCACGG - Intergenic
1160397576 18:78583538-78583560 CCCCACAGGCCTCAGGAGCACGG - Intergenic
1161077235 19:2291723-2291745 CGCCGCGGGCAGCAGGAGCAGGG + Exonic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1161849790 19:6732372-6732394 CCCTTCAGCCTGAAGGAGCAGGG + Exonic
1162579761 19:11521925-11521947 CGCCACCGGCAAAAGGAGCCTGG - Intronic
1163118200 19:15200589-15200611 CCCCAGAGGCCCAAGGAACAGGG - Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165047580 19:33117844-33117866 ACGCACAGGCTGAAGGAGAAGGG + Exonic
1165313028 19:35040041-35040063 CCAAACAGGCAGCAGAAGCAGGG - Intronic
1166042650 19:40213068-40213090 CCCCGCAGGCTGAAGGGGCTGGG + Exonic
1167646728 19:50710085-50710107 CCCCACAGGCAGATGGGGGTGGG - Intronic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925133443 2:1510502-1510524 ACCCACAGAAAGAAGGAGAAAGG + Intronic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931460304 2:62444247-62444269 CCCCACTGGCAAAAGGACCCAGG + Intergenic
932121698 2:69106725-69106747 TCCCACAGGGTGAAGGTGCATGG - Intronic
932515840 2:72348158-72348180 GCTCACAGGTAGAAGGAGTAAGG + Intronic
932618249 2:73249806-73249828 CTCCACAGGCCTAGGGAGCAAGG - Exonic
934765888 2:96879802-96879824 CCCGGCAGGCAGAGGGAGCTGGG - Intronic
935519047 2:104081503-104081525 CCACAAAGGCAGAAAAAGCATGG - Intergenic
935671456 2:105560213-105560235 CCCCACTGGCAGAACCAGCAAGG - Intergenic
936013131 2:108938127-108938149 CCACAGAGGCAGGAAGAGCATGG + Intronic
936151966 2:110026988-110027010 CTCCCAAGGCAGAAGGAGCCTGG + Intergenic
936192712 2:110344425-110344447 CTCCCAAGGCAGAAGGAGCCTGG - Intergenic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
938945688 2:136210147-136210169 CCCCACTTGCAGAAGGCACACGG + Intergenic
939217641 2:139260187-139260209 CCCTAGAGGCAGAGAGAGCAGGG + Intergenic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940835165 2:158513334-158513356 CCTCACAGGCAGATGCATCAGGG - Intronic
941965308 2:171294900-171294922 CCCTACAGCCAGTGGGAGCAAGG + Intergenic
942271073 2:174275928-174275950 CCACAAAGGAAGAAGAAGCATGG - Intergenic
943242472 2:185403242-185403264 CACCTAAGCCAGAAGGAGCAAGG - Intergenic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
944208752 2:197184681-197184703 CCCCAAAGGGAAAAAGAGCATGG - Intronic
944936558 2:204575652-204575674 CCCCACAGCCAGAGAGAGCCAGG - Intronic
946592203 2:221262916-221262938 CCACACAGGCAAAATTAGCATGG - Intergenic
947271896 2:228345671-228345693 CCCCAGAGGCAGAGGTTGCAAGG - Intergenic
947605468 2:231483022-231483044 CCCCACTCGCAGATGCAGCAGGG + Intronic
947857401 2:233333443-233333465 CCCCAAAGGCTGGAGGAGCCTGG + Intronic
948408718 2:237742754-237742776 CCTCCCAGGCAGAAGGACCGGGG - Intronic
948502963 2:238408373-238408395 GCCCCCAGGCAGATGGAGCCTGG + Intergenic
948570067 2:238912422-238912444 AGCCCCAGGCAGAAGGGGCAAGG + Intergenic
948760084 2:240184905-240184927 CCCCACCCGCAGAGGCAGCAAGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1172145383 20:32754120-32754142 CTCCTGAGGCACAAGGAGCACGG - Intergenic
1172147226 20:32764956-32764978 CCCCACTGGCAGCAGGTCCATGG - Intronic
1173018200 20:39245722-39245744 TCCCAGAGGCAGAAGGAGTAGGG + Intergenic
1173125264 20:40330719-40330741 TCACACAGGAAGAAGTAGCAGGG + Intergenic
1173474029 20:43345958-43345980 CCCCACAGGCAGATGGATGCTGG - Intergenic
1173962731 20:47087730-47087752 CCCCAAAGTGAGAAGCAGCAAGG + Intronic
1175089919 20:56493975-56493997 TCCCACAGGCACAGGGAGGAGGG - Intronic
1175768134 20:61605276-61605298 CCCCACAGGCAGCAGGGCCCTGG - Intronic
1175989300 20:62779531-62779553 CCCCGCTGTGAGAAGGAGCAGGG + Intergenic
1176023723 20:62975368-62975390 CCCCAGTGGCAGAAGGGGCCCGG + Intergenic
1176070568 20:63224178-63224200 CTCCACACGCAGAGTGAGCAGGG - Intergenic
1176106776 20:63393300-63393322 GCCCAGAGGAGGAAGGAGCAGGG + Intergenic
1176106824 20:63393430-63393452 GCCCAGAGGAGGAAGGAGCAGGG + Intergenic
1176369324 21:6052939-6052961 CCTCACACGTGGAAGGAGCAAGG - Intergenic
1176512805 21:7761451-7761473 CCCCACAGGCAGAGATGGCAGGG + Intronic
1176861935 21:14015591-14015613 CCCCACAGGAAGAAGGTCCCTGG + Intergenic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1178646918 21:34391975-34391997 CCCCACAGGCAGAGATGGCAGGG + Intronic
1179317373 21:40255853-40255875 GCCCACAGTCAGAAAGAGCCAGG + Intronic
1179754195 21:43485602-43485624 CCTCACACGTGGAAGGAGCAAGG + Intergenic
1179788863 21:43744127-43744149 CCCTAAAGGCGGAAGGGGCAAGG + Intronic
1180160949 21:45998445-45998467 GCCCACAGCCAGATGGAGGAGGG - Intronic
1180986876 22:19910159-19910181 CCCCACAGGCAGGAGCTGCCTGG + Intronic
1181633121 22:24161801-24161823 CCACACAGGAGGAAGGGGCATGG - Intronic
1182076459 22:27498760-27498782 CCCCACAGGCAGAATGATCGTGG + Intergenic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182234484 22:28864725-28864747 TCCCACACGCACCAGGAGCAGGG + Intergenic
1182699092 22:32218541-32218563 CACCACAGCCAGGAGGAGGATGG + Exonic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1182933839 22:34201216-34201238 CCACACTGGTAGAAGCAGCAGGG - Intergenic
1183409667 22:37647433-37647455 CCCCCCAGCCTGAAGGAGCCAGG + Exonic
1183457219 22:37929438-37929460 CTCAACAGGCAGAAGGACCCAGG + Intronic
1183520433 22:38293603-38293625 GCCCACAGGCAGGAGGACGAGGG + Intronic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184408420 22:44313174-44313196 TCCCACAGCTAGAAGCAGCAGGG + Intergenic
1184472689 22:44704592-44704614 CACCCCAGGCAGCAGGGGCACGG + Intronic
1184923750 22:47623551-47623573 CATCACAGGCAGAAAGCGCACGG + Intergenic
1185068643 22:48644441-48644463 CACCATGGGCAGAAGGAGCTGGG + Intronic
1185123854 22:48993057-48993079 CTCCATGGGCAGAAAGAGCAGGG - Intergenic
1185201152 22:49506254-49506276 CCCCAGTGGAAGAAGCAGCATGG - Intronic
950136041 3:10581568-10581590 GTCCACAGGCAGGAGGAGAAGGG + Intronic
950210246 3:11117749-11117771 GCCCTCAGGCAGCAGGAGGAAGG + Intergenic
950737845 3:15025044-15025066 GCCCAAAGACAGAAGGTGCAAGG - Intronic
951476397 3:23110971-23110993 TCCCACAGGCATAGGGTGCACGG + Intergenic
951792957 3:26506885-26506907 CTCCACAAGCAGAGAGAGCAGGG - Intergenic
952958235 3:38573898-38573920 CCCCACAGGAGGAGGCAGCATGG + Intronic
953853044 3:46480394-46480416 CACCACAGGCACAATGGGCATGG - Intronic
954138499 3:48593376-48593398 GCCCAAAGGCTGAAGGGGCAGGG - Exonic
954152019 3:48662531-48662553 CCCCTCAGCCAGGAGGAGCTGGG - Exonic
954436615 3:50499643-50499665 GCACACAGGCAGGAGGAGAAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954674421 3:52307891-52307913 CCCCACACAGAGACGGAGCAGGG - Intergenic
954692645 3:52403880-52403902 CCCCACAGGTATAAGGGGAAGGG - Exonic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955867657 3:63402107-63402129 CCCTGCAGCCAGAAGGAGGAAGG + Intronic
956095827 3:65714930-65714952 CCCGAAACTCAGAAGGAGCAGGG + Intronic
961768262 3:129229018-129229040 CACCCCAGGCAGAGGGAGAAAGG - Intergenic
961804822 3:129481866-129481888 CCACACAGGCACAAGCCGCAGGG + Intronic
962082129 3:132150805-132150827 CCCCACACTCAGAAGGACCCTGG + Intronic
962254738 3:133862627-133862649 CTCCAAGGGCAGTAGGAGCAGGG + Intronic
962453072 3:135538086-135538108 CCCCAATGGGAGAAGGAGCCAGG - Intergenic
963062297 3:141234661-141234683 ACCCACTGGCAGATGGGGCAAGG + Intronic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
963359179 3:144248756-144248778 CCCATCAGACAGAAGGAGCCAGG + Intergenic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
965905698 3:173702407-173702429 CCCAACAGGCACCATGAGCAAGG - Intronic
967101191 3:186217118-186217140 CCCCACAGGCTGCAGGGGTAAGG + Intronic
968462522 4:732444-732466 CCCCGCAGGGAGGAGGAGAAGGG + Intronic
968597298 4:1492018-1492040 CCCGACAGGCAGAAGCAGCCTGG + Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968967641 4:3777156-3777178 GCCCACTGGCTGCAGGAGCAGGG + Intergenic
969494520 4:7518928-7518950 TCCCACAGGCAGCAGGTGCGAGG - Intronic
969569148 4:7998471-7998493 CCCCACAGGCAGCACCGGCAGGG - Intronic
969707394 4:8819233-8819255 CCCAAGAGGGAGAAGGGGCAGGG + Intergenic
971635068 4:29047495-29047517 CCCCGCAGGCTGAGGGAGCCAGG - Intergenic
973646847 4:52958604-52958626 CACCATAGGCACAAGGAGAAAGG + Intronic
976116422 4:81733139-81733161 CCCAAAAGGCAGAAGGAGCGTGG + Intronic
976611478 4:87035170-87035192 CCCTTCAAGCACAAGGAGCAGGG - Intronic
976629224 4:87220141-87220163 CCCCATTGGCGGGAGGAGCAGGG - Intronic
978139737 4:105304920-105304942 ACCCACAGCCAGAAGAAGGAAGG + Intergenic
978758338 4:112328200-112328222 GCCCACAGACAGAAGGAACCTGG - Intronic
981008157 4:139896906-139896928 ACCCACAGCAAGGAGGAGCATGG + Intronic
981251844 4:142612212-142612234 CTTCAGAGGCAGAAGCAGCAGGG - Intronic
981310919 4:143297411-143297433 GCCCACAGACAGAAGGGCCAGGG - Intergenic
982866182 4:160514735-160514757 TGCTACAGGCAGAAGCAGCATGG - Intergenic
983472566 4:168174538-168174560 CCCAACAGGCTGAATGGGCAGGG + Intronic
984501623 4:180565749-180565771 CCACACAGGCCGAGGGAGAAGGG - Intergenic
985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG + Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985494714 5:198018-198040 CACCAGGGGCAGAAGGAGAAAGG - Exonic
985781274 5:1873152-1873174 TCGCAAAGACAGAAGGAGCAAGG + Intergenic
985817151 5:2135520-2135542 CCCCCCACCCAGAAGCAGCATGG - Intergenic
985876929 5:2606994-2607016 CACACCAGGCAGATGGAGCAGGG - Intergenic
986008127 5:3684939-3684961 CCCCAGAGACAGAGGGACCAGGG - Intergenic
989507519 5:42244394-42244416 CCAGACAGGCAGTAGGAACAGGG - Intergenic
991472042 5:66979342-66979364 AACCACAGGAACAAGGAGCAAGG - Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993379415 5:87189171-87189193 CCCTAAAGGCAGAGGCAGCATGG + Intergenic
994428830 5:99628920-99628942 CACCCCAGGCAGCAGCAGCAAGG - Intergenic
994452007 5:99955323-99955345 CACCACAGGCACCAGGAACATGG + Intergenic
994820411 5:104643442-104643464 CCCCACATGAAGAAACAGCACGG + Intergenic
994925813 5:106115561-106115583 CACCTCAGGCAGGAGGACCATGG - Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
996444794 5:123534670-123534692 GCCCACAGTCTGAAGGAGCTTGG + Intronic
996538596 5:124605433-124605455 CACAATAGTCAGAAGGAGCAGGG - Intergenic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
1000393517 5:160749376-160749398 GGCCACAGGAAGAAGGAGCTGGG + Intronic
1001455376 5:171856023-171856045 CCTCAGCGTCAGAAGGAGCAAGG + Intergenic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1002473237 5:179450080-179450102 GTCCCGAGGCAGAAGGAGCAAGG + Intergenic
1002480984 5:179500573-179500595 GTCCCGAGGCAGAAGGAGCAAGG - Intergenic
1002588952 5:180274594-180274616 GCCAACAGGCTGAAGGAGCTTGG + Intronic
1002630312 5:180570280-180570302 CCCCAGAGGCAGAAGTTGCAGGG + Intronic
1003447853 6:6200976-6200998 CCCATCAGGCAGAAGGACCCAGG + Intronic
1004016477 6:11736600-11736622 CCACACAGGGAGAGGAAGCAGGG - Intronic
1004170742 6:13293873-13293895 GGCCACAGGCAGAAAGATCATGG - Intronic
1004660791 6:17707199-17707221 ACCGACAGGGAGAAGGAGAATGG - Intergenic
1006915613 6:37591984-37592006 CCCACCAGGCAGGAGGAGCTGGG - Intergenic
1007264135 6:40584763-40584785 CCCCACAGGCTGAAGAGGCTTGG + Intronic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1008208060 6:48687072-48687094 TCCCACTGCCAGAAGGGGCAGGG - Intergenic
1012010242 6:93774699-93774721 CCCTAAAGGCAGAAAAAGCAGGG + Intergenic
1012745817 6:103087327-103087349 TCCCACAGACAGAAAGAGTAGGG + Intergenic
1012953485 6:105543471-105543493 CCCCACAGGCAGGGGGATTATGG - Intergenic
1015584176 6:134758716-134758738 ACCCACAGGCAGAAACTGCATGG + Intergenic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1016894081 6:149035680-149035702 CCCCAGAGGCAGAGGTTGCAGGG + Intronic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1017545361 6:155445271-155445293 ACCCACAGTGAGAAGTAGCAGGG + Intronic
1017600644 6:156077101-156077123 GCTCGCAGACAGAAGGAGCAGGG + Intergenic
1018635921 6:165859432-165859454 CCCCAAGGGAAGGAGGAGCAGGG - Intronic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019028835 6:168993426-168993448 CCCAACAGGCAGAGGCTGCAGGG - Intergenic
1019306410 7:337376-337398 CCCCACGGGCAGCAGGATCAAGG + Intergenic
1019424574 7:968276-968298 ACCCACAGGCAGAGGGACGAGGG + Exonic
1019769812 7:2876600-2876622 GCCCACGGGCAGCAGGAGGATGG + Intergenic
1020240614 7:6391774-6391796 CCCTGCAGGCACAAGGAGGAAGG - Intronic
1021806465 7:24361825-24361847 CCACAGAGGGAAAAGGAGCAGGG - Intergenic
1023905872 7:44521304-44521326 ACCTACAGGCAGAAGGGGAAAGG + Intronic
1026329595 7:69340152-69340174 CCCAACAGGCAAAAGCTGCAGGG - Intergenic
1027247245 7:76375491-76375513 CCCCACACGCAGACGGAGGCAGG + Intergenic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1031801952 7:126257978-126258000 CCCATCAGGCAGAAAGAGTAGGG + Intergenic
1032498432 7:132380445-132380467 CCGCCCAGACAGAAGGACCAAGG + Intronic
1033254494 7:139788543-139788565 CCCCACATTCAGAAGGACCATGG - Intronic
1034355536 7:150448278-150448300 CGCCTCAGGCAGACGGAGAATGG - Intergenic
1034567363 7:151926198-151926220 CCGCACAGGGACATGGAGCACGG - Intergenic
1034963379 7:155375797-155375819 CCCCACAGGAGGGAGGAGGAAGG + Intergenic
1034993028 7:155559967-155559989 CCCCACAGCCGGCAGGTGCAGGG + Intergenic
1035263235 7:157674826-157674848 CCCCCCCGGCAGGAGGAGCTCGG - Intronic
1035289427 7:157828105-157828127 CCCCACATGCAGATGGAGCTGGG + Intronic
1035522326 8:284728-284750 CCCCACGGGCCGACGCAGCAGGG + Intergenic
1041034745 8:53776528-53776550 CCCCACAGGAAGAGAGAGCTTGG + Intronic
1041205609 8:55495370-55495392 CCACCCACTCAGAAGGAGCAGGG + Intronic
1041705998 8:60846894-60846916 CACCACAGCCCCAAGGAGCAGGG - Intronic
1045559075 8:103243644-103243666 CTGCTTAGGCAGAAGGAGCAGGG + Intergenic
1048250615 8:132863928-132863950 CCCCACCTGGAGAAGCAGCAAGG - Intergenic
1049037284 8:140086502-140086524 CCCCAGAGGCAGCAGGAGCTGGG - Intronic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1051923920 9:22299861-22299883 CACCACAGACAGAAACAGCATGG - Intergenic
1052540469 9:29804869-29804891 GGGCACAGGAAGAAGGAGCAAGG + Intergenic
1052860730 9:33436370-33436392 CCCCTCAGCCAGAAGAGGCAAGG + Intergenic
1053072714 9:35110679-35110701 CCCAACATGCTGAGGGAGCAAGG + Exonic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1054928620 9:70613670-70613692 CTCCACAGGCAGAAACAGCAGGG - Intronic
1055576435 9:77664297-77664319 CCCCACAGGCTTAGGGATCATGG + Intergenic
1056471450 9:86908415-86908437 ACCCACAGGCACAAGGAGGCGGG + Intergenic
1056958507 9:91101601-91101623 CCCTACAGGCAGGAGGGGGACGG - Intergenic
1057573164 9:96219245-96219267 CACCAAAGGCACGAGGAGCAGGG - Intergenic
1058105597 9:100967571-100967593 GTCCACTGGCAGAGGGAGCAGGG + Intergenic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1060751775 9:126174279-126174301 CCCCAAAGGCAGGAGTACCAGGG - Intergenic
1061081725 9:128374805-128374827 ACCCAGAGGGAGAAGCAGCATGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062232071 9:135487291-135487313 CCCCTCGGGCAGGAGCAGCAGGG - Exonic
1062254525 9:135614773-135614795 CCACACAGGGAGGAGGAGCTGGG - Intergenic
1062362538 9:136194455-136194477 CCCCACAGGCAGAGGCCGCTGGG + Intergenic
1062517994 9:136945644-136945666 GCCCACAGCCACAAGGAGCCAGG - Exonic
1062648614 9:137564076-137564098 GACCACAGGCAGGAAGAGCATGG + Intronic
1185506554 X:635509-635531 CCCCACAGCCGGAGGGAGGAGGG - Intronic
1185586084 X:1243029-1243051 CCCCACAGGAGGAAAGAGCAGGG + Intergenic
1185987871 X:4856030-4856052 CCCCACAGGTAGAAGCGGCAGGG + Intergenic
1187268558 X:17759581-17759603 AGCCACAGACAGAAGGAGCCTGG - Intergenic
1187369400 X:18692160-18692182 TCCCACAGGCAGGAGAAGCCTGG - Intronic
1187631263 X:21175312-21175334 CCCCAGAGGGAGAAAGAGTATGG + Intergenic
1189240172 X:39518817-39518839 CCCCACTGGCAGGAGGGGAATGG + Intergenic
1189944377 X:46163195-46163217 CCCCACACCACGAAGGAGCATGG - Intergenic
1190302576 X:49065240-49065262 ACCCATAGGAAGATGGAGCATGG - Intronic
1190311015 X:49117109-49117131 CCCCACAGCCAGACGAACCATGG + Exonic
1192784016 X:74320672-74320694 CCCCACAGACAGCAAGAGAAGGG + Intergenic
1195111765 X:101657223-101657245 CCCAAGAGGCAGATGGAGCCGGG - Exonic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1195340827 X:103904619-103904641 GCCCACAAGCAGAAGAGGCATGG - Intergenic
1195389662 X:104348325-104348347 GGCCAGAGGAAGAAGGAGCAGGG + Intergenic
1197015314 X:121618403-121618425 GCCCACAGTTAGTAGGAGCAAGG - Intergenic
1197108126 X:122740127-122740149 CCCCTCAGGCAGCACTAGCAGGG + Intergenic
1198398828 X:136250913-136250935 CCCCAAGGGCAGATGGGGCACGG + Intronic
1199753750 X:150845600-150845622 CCCCAAAGCCAGAAGATGCAAGG + Intronic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200354505 X:155534241-155534263 CACCACAGGCCCAAGGGGCAGGG + Intronic
1200426138 Y:3022365-3022387 ACCCACAGGCAAAAACAGCATGG - Intergenic