ID: 912649671

View in Genome Browser
Species Human (GRCh38)
Location 1:111426641-111426663
Sequence AATGTGTGCTCTCCCTTACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912649671_912649673 -5 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649673 1:111426659-111426681 ACATTAGTTGGCAAAAACCAAGG 0: 1
1: 0
2: 0
3: 16
4: 142
912649671_912649678 5 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649678 1:111426669-111426691 GCAAAAACCAAGGGAGGGGATGG 0: 1
1: 0
2: 2
3: 58
4: 538
912649671_912649676 0 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649676 1:111426664-111426686 AGTTGGCAAAAACCAAGGGAGGG 0: 1
1: 0
2: 2
3: 21
4: 192
912649671_912649675 -1 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649675 1:111426663-111426685 TAGTTGGCAAAAACCAAGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 138
912649671_912649674 -4 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649674 1:111426660-111426682 CATTAGTTGGCAAAAACCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 200
912649671_912649677 1 Left 912649671 1:111426641-111426663 CCTGGTAAGGGAGAGCACACATT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 912649677 1:111426665-111426687 GTTGGCAAAAACCAAGGGAGGGG 0: 1
1: 0
2: 0
3: 23
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912649671 Original CRISPR AATGTGTGCTCTCCCTTACC AGG (reversed) Exonic
907258867 1:53201035-53201057 AATGTGTACTTTCCCTTAGCAGG + Intronic
910488605 1:87743480-87743502 AATGTCTGCTTTCCATTCCCTGG + Intergenic
912649671 1:111426641-111426663 AATGTGTGCTCTCCCTTACCAGG - Exonic
922144684 1:222928933-222928955 AATATGTGCTTGCCATTACCAGG + Intronic
924412302 1:243819197-243819219 GATGGCTGCTCTCCCTTCCCTGG - Intronic
924628654 1:245716475-245716497 AATGATTGCTCTCCCTTCCATGG + Intergenic
1064620349 10:17209597-17209619 TATGTGTGTTTTCCCTTTCCTGG - Intergenic
1069717998 10:70532969-70532991 GATGGCTGCTCTCCCTCACCTGG + Intronic
1070834391 10:79438750-79438772 ACTGTCTGCTCCCCCTTTCCTGG - Intronic
1077390046 11:2296649-2296671 AATGGGTGGCCTCCCTTGCCTGG - Intronic
1079492516 11:21005077-21005099 AATATGAGCTCTCCCTTTTCAGG - Intronic
1081694215 11:45098371-45098393 CATCTGTGCTCTTCCTTCCCTGG - Intronic
1082889697 11:58125700-58125722 GAAGTGTGGTCTCCCTGACCGGG - Intronic
1083025746 11:59549364-59549386 ACTGTGTTCTGTCCCTGACCAGG + Intergenic
1084385319 11:68839977-68839999 AGTGTGTGCACTCCCAAACCTGG + Intronic
1086088600 11:82982211-82982233 AATGTATCCTCACCCTTACCTGG - Exonic
1088029361 11:105227568-105227590 AATGTAGACTCTCCCTTACCAGG - Intergenic
1089028962 11:115302902-115302924 AATGTGTCTTCTTCCTAACCTGG - Intronic
1089108960 11:116039311-116039333 AATGTGTGCACTCATATACCAGG + Intergenic
1089365945 11:117921156-117921178 AATCTGAGCTGTCACTTACCTGG - Intronic
1090625993 11:128609375-128609397 TCTGTGCCCTCTCCCTTACCAGG + Intergenic
1090681578 11:129064847-129064869 ACTGTGGGCCCGCCCTTACCTGG - Exonic
1093187589 12:16038849-16038871 AATGTCTGCCCATCCTTACCTGG + Intergenic
1095483626 12:42661244-42661266 TCTGTGTGCTCACCCTGACCTGG - Intergenic
1097956330 12:65489314-65489336 AAATTGTGTTCTCCCTAACCTGG - Intergenic
1101754334 12:107609178-107609200 GCTGTGTCCTCTCCCTTTCCAGG + Intronic
1105417041 13:20222260-20222282 AATGACTGGTCTTCCTTACCTGG - Exonic
1106521351 13:30500510-30500532 CATGTGTGTGCTCCCTCACCTGG + Intronic
1106713449 13:32362845-32362867 AATGTGTGATCTCTCTTAAATGG - Intronic
1106724293 13:32468885-32468907 AAGGTTGGCTCTCCCTTACAGGG - Intronic
1107640811 13:42441269-42441291 CAGGTGTGCTCTACCATACCTGG - Intergenic
1111202378 13:84956270-84956292 ATTATGTGTTCTGCCTTACCTGG + Intergenic
1112301338 13:98233408-98233430 AATGTGTGCTCTCGGTGAGCAGG + Intronic
1113692328 13:112319692-112319714 GGTGTGTGCTCTCGCTTCCCTGG - Intergenic
1114505966 14:23213679-23213701 ACTGTGTGCTCTACCTAAACAGG + Intronic
1116421686 14:44740154-44740176 AATGTGTCCTCTCCCTTTAAGGG + Intergenic
1117101679 14:52355053-52355075 AATGTGTGATATCCCTAAACTGG + Intergenic
1122386389 14:101351153-101351175 AATGTGTGTCCTCCCTTGGCTGG + Intergenic
1122665579 14:103327182-103327204 TGTGTGTGCTCTCCCCTTCCAGG - Intergenic
1124089526 15:26585131-26585153 AATGTGTGCTCCACCTCTCCAGG + Intronic
1124089766 15:26587595-26587617 AATGTGTGCTCCACCTCTCCAGG + Intronic
1125527903 15:40389926-40389948 GCTGTGTGCTGTCTCTTACCTGG - Exonic
1126750009 15:51867017-51867039 TGTGTGTGGTCTCCCTTCCCTGG - Intronic
1133888284 16:9852745-9852767 AATGTCTGTTCTCCTTTATCTGG - Intronic
1135624600 16:23982845-23982867 CATGTGTGCAGTCCCCTACCTGG + Intronic
1139510310 16:67424492-67424514 AAGAAGTGCTCTCCCTTGCCTGG + Intergenic
1140686972 16:77443001-77443023 AATGTGTGCACACACTCACCTGG - Intergenic
1144840257 17:18181713-18181735 AATCTGTGCTGTCCCTCACCGGG - Intergenic
1147254686 17:39174768-39174790 AATCTGTGGCCTCCCTTTCCAGG + Exonic
1153102144 18:1485317-1485339 AATGTGAGCTCTCACTCACCTGG + Intergenic
1155208809 18:23583673-23583695 ACAGTGTGCTCTCTCTTTCCTGG - Intronic
1157516376 18:48314712-48314734 ACTGTGGGCTCTTCCTTCCCTGG - Intronic
1157982166 18:52394406-52394428 CACGTGTGCTCTACCATACCTGG + Intronic
1161029895 19:2052711-2052733 AATGTGTGCTCTCACAGTCCTGG + Intergenic
1162748758 19:12815069-12815091 AATGTGTGAGCTACCATACCTGG + Intronic
925483822 2:4305631-4305653 AGAATGGGCTCTCCCTTACCAGG - Intergenic
928328012 2:30335377-30335399 AGTGTGTGCTCTGCTTTCCCTGG - Intergenic
931377603 2:61721428-61721450 CAAGAGTGCACTCCCTTACCAGG - Intergenic
939965577 2:148607152-148607174 AATGTGTTCTGTCCTTTGCCAGG + Intergenic
943705614 2:191030863-191030885 AATGTGTTTTCTCCCTACCCAGG + Intronic
944286005 2:197950382-197950404 CATGTCTGATCTCCCTTCCCTGG - Intronic
946370356 2:219278002-219278024 AATGCTTGCTCTCCCTGACTCGG - Intronic
1169334873 20:4747952-4747974 AATGTGTGCGCTTCCTTGCATGG + Intergenic
1170530291 20:17284460-17284482 CATGTCTGCTCTCCCTCACAAGG - Intronic
1170703869 20:18727728-18727750 ACTGTGTGCCCTCCTTTACATGG - Intronic
1170940258 20:20842820-20842842 AATGTGTCCCCTCCCTCACCAGG - Intergenic
1172300159 20:33844120-33844142 AAGGTGTGCTCTCTCATACTGGG - Intronic
1175126868 20:56758969-56758991 AGTGTGTGCTCCCACTTCCCTGG - Intergenic
1181391548 22:22586921-22586943 AATGTGTCCTCTGCCATACCAGG - Intergenic
1182863554 22:33582316-33582338 AATGTGTACTCTCCTGTACCAGG - Intronic
1183922612 22:41181492-41181514 CATGTGTGCTCTGCCTGGCCTGG - Intergenic
949354828 3:3169204-3169226 AAGGAATGCTCTCCTTTACCTGG + Intronic
949752396 3:7369388-7369410 AATGTGTGCCCTCACCTCCCTGG - Intronic
955371016 3:58352105-58352127 AATGTGTGCCCTCCCCTGCTGGG + Intronic
957361957 3:79172468-79172490 GAAGTGTGCTCTTCCTTACACGG - Intronic
959480398 3:106865371-106865393 AAAGTTTGCTCTCCCTTTCATGG - Intergenic
960812129 3:121635554-121635576 GATGTGAGCTCCGCCTTACCTGG + Intronic
963304720 3:143638827-143638849 TATGTGGGCTCTGCCTTACTGGG - Intronic
966261274 3:177982380-177982402 AATATGTGGTCTCCCTGACCTGG + Intergenic
966585338 3:181617426-181617448 AATGTGGGCTCTCCCTTCACTGG + Intergenic
971178220 4:24302375-24302397 AATGTCTGTTCTCCCTTCGCAGG + Intergenic
971179392 4:24314735-24314757 AATGTGTTCTGTCCATCACCTGG + Intergenic
973306748 4:48660509-48660531 CATGTGGGCACCCCCTTACCTGG - Intronic
977578591 4:98700672-98700694 AATGTGGGCTCTCCCTGTCATGG + Intergenic
979628716 4:122876370-122876392 AGTGTGTGCTAACCGTTACCTGG + Exonic
980177983 4:129370038-129370060 TAAGTGTGGTCTCCCCTACCAGG - Intergenic
982848821 4:160284572-160284594 AATGTCTGATGTCACTTACCTGG + Intergenic
983093502 4:163535597-163535619 AATGTGTGCTGCCACTTATCTGG - Intronic
987507931 5:18797486-18797508 AATGTGTGATCTCACTTTTCAGG + Intergenic
995056253 5:107762449-107762471 AATCTTTGGTCTCCCTCACCAGG - Intergenic
995269241 5:110202670-110202692 AATGTATGCTTTCCCTTATTTGG + Intergenic
996239179 5:121172726-121172748 TGTGTGTGCTCTCTCTTAACAGG - Intergenic
998639748 5:143996117-143996139 AAACTGTTCTCTCCCTTCCCTGG + Intergenic
1004450227 6:15738643-15738665 AATGTGTGATCACCCTGGCCTGG + Intergenic
1004469417 6:15916090-15916112 ATATTGTGCTCTCCCTTACCAGG + Intergenic
1005143593 6:22662557-22662579 AATGTCTGCTTTCCCTGACGGGG - Intergenic
1007539309 6:42626411-42626433 AAAGTGTCCTCTCACTTTCCAGG - Intronic
1023578516 7:41655924-41655946 AATATGTGCTGTACCTCACCTGG + Intergenic
1023833966 7:44057761-44057783 AATGAGTGCTGTCCCCTACAGGG + Exonic
1024572155 7:50732253-50732275 TATATGTGCTCGCCCATACCTGG + Exonic
1025012440 7:55408313-55408335 ATTGTGTGTTCTCCCTCACTAGG - Intronic
1029092770 7:98061185-98061207 ACTGTGTGATCTCACTTACATGG - Intergenic
1031838116 7:126703700-126703722 CAGGTGTGCTCTGCCATACCTGG + Intronic
1033262167 7:139853359-139853381 AGTCTGTGCTCACCATTACCAGG - Intronic
1035901920 8:3465859-3465881 AGTGTGTGCCCTCTCATACCTGG - Intronic
1039206666 8:35163428-35163450 AATGGGTGCTCTTCCTCTCCAGG + Intergenic
1040683540 8:49842621-49842643 TGTGTGTGCTCCCCCTTACAAGG + Intergenic
1042552895 8:70010121-70010143 CATGTGTGCTCCACCATACCAGG - Intergenic
1044668306 8:94653423-94653445 AATGTGTGCTGCCACTTAGCTGG + Intronic
1049038621 8:140096033-140096055 AATGTGCGCCCTCCCTCACGTGG - Intronic
1049288561 8:141789855-141789877 AATGAGCGCTCTCCCTTCCCTGG + Intergenic
1050554805 9:6780053-6780075 AATGTATGGTATCCCTTATCTGG - Intronic
1052397890 9:27963060-27963082 AATGTGTGCTCACTTATACCTGG + Intronic
1057740689 9:97708901-97708923 ACTTTATGCTCTCACTTACCTGG + Intergenic
1058555174 9:106159253-106159275 AATGTGTGCTCTCTGTTAAATGG - Intergenic
1060349177 9:122842686-122842708 TAAGTTTCCTCTCCCTTACCTGG + Intergenic
1188199886 X:27284639-27284661 TATGTGAACTCTCACTTACCAGG - Intergenic
1190812311 X:53896570-53896592 AATGTGTGATCTCTCATATCAGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1197699393 X:129587115-129587137 AAGGTCTACTCTCACTTACCTGG - Exonic