ID: 912652127

View in Genome Browser
Species Human (GRCh38)
Location 1:111449038-111449060
Sequence GGTCCGGTGAGCCGAGATCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 591}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652127_912652141 28 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652141 1:111449089-111449111 CATGCAGGCGGGCGCATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 58
912652127_912652133 13 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652133 1:111449074-111449096 CTCCAACTGCCGTTCCATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
912652127_912652136 17 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652127_912652140 27 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652127_912652138 26 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652127_912652142 29 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652127_912652135 16 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652135 1:111449077-111449099 CAACTGCCGTTCCATGCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912652127 Original CRISPR GGTCCGGTGAGCCGAGATCC CGG (reversed) Exonic