ID: 912652127

View in Genome Browser
Species Human (GRCh38)
Location 1:111449038-111449060
Sequence GGTCCGGTGAGCCGAGATCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 591}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652127_912652133 13 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652133 1:111449074-111449096 CTCCAACTGCCGTTCCATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
912652127_912652136 17 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652127_912652142 29 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652127_912652140 27 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652127_912652135 16 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652135 1:111449077-111449099 CAACTGCCGTTCCATGCAGGCGG 0: 1
1: 0
2: 0
3: 11
4: 68
912652127_912652138 26 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652127_912652141 28 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652141 1:111449089-111449111 CATGCAGGCGGGCGCATTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912652127 Original CRISPR GGTCCGGTGAGCCGAGATCC CGG (reversed) Exonic
900196405 1:1378237-1378259 GTTACAGTGAGCCGAGATCACGG - Intergenic
900475197 1:2873177-2873199 GGTCTCCTGAGCCGATATCCAGG - Intergenic
901393854 1:8966169-8966191 GTTGCAGTGAGCCGAGATCAAGG - Intronic
901400246 1:9010784-9010806 GGTGCAGGGAGCCAAGATCCAGG - Intronic
901449202 1:9325861-9325883 GGCCCGGTGTGCCCAGAGCCAGG + Intronic
901674299 1:10873967-10873989 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
902386760 1:16080255-16080277 GTTGCGGTGAGCCGAGATCGCGG + Intergenic
902821874 1:18948447-18948469 GGTCCGTGGAGCCCAGGTCCTGG - Intronic
903201384 1:21742480-21742502 GTTGCGGTGAGCCAAGATCGCGG + Intronic
903246055 1:22016387-22016409 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
903642608 1:24870373-24870395 GTTGCAGTGAGCCGAGATCATGG - Intergenic
903932093 1:26868391-26868413 GCTGCAGTGAGCCGAGATCGTGG - Intergenic
904215133 1:28913374-28913396 GTTGCAGTGAGCCGAGATTCCGG + Intronic
904516859 1:31062556-31062578 GTTGCAGTGAGCCGAGATCAAGG + Intronic
904930145 1:34081489-34081511 GTTGCAGTGAGCCGAGATCACGG - Intronic
905724907 1:40243001-40243023 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
905730364 1:40295083-40295105 GTTGCGGTGAGCTGAGATCGGGG - Intergenic
905872318 1:41412102-41412124 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
906235115 1:44202065-44202087 GTTGCGGTGAGCCGAGATCACGG - Intergenic
906341147 1:44982358-44982380 GTTGCAGTGAGCCGAGATCACGG - Intronic
907043308 1:51282614-51282636 GTTGCGGTGAGCCGAGATCACGG + Intergenic
907147667 1:52250769-52250791 GATGCGGTGAGCTGAGATCATGG - Intronic
907375644 1:54036217-54036239 GTTGCAGTGAGCCAAGATCCTGG + Intronic
907501924 1:54887264-54887286 GGTTCGGTGGGCCGAGACCCGGG + Intergenic
909412180 1:75367526-75367548 GGTCCTCTGAGCCATGATCCAGG - Intronic
910021299 1:82592837-82592859 GTTTCAGTGAGCCGAGATCATGG - Intergenic
910360165 1:86408195-86408217 GTTGCAGTGAGCCGAGATCATGG + Intergenic
910928434 1:92419430-92419452 GTTTCAGTGAGCCGAGATCACGG + Intergenic
911194238 1:94977708-94977730 GTTGCAGTGAGCCGAGATCATGG - Exonic
912366845 1:109140911-109140933 GTTGCAGTGAGCCGAGATCGTGG - Intronic
912652127 1:111449038-111449060 GGTCCGGTGAGCCGAGATCCCGG - Exonic
912962752 1:114210438-114210460 GGTGTGGTGAGCCCAGAACCAGG - Intergenic
914266234 1:146040639-146040661 GTTGCAGTGAGCCGAGATCGGGG - Intergenic
914838317 1:151226649-151226671 GTTGCAGTGAGCCGAGATCGTGG + Intronic
915295359 1:154917458-154917480 GTTGCAGTGAGCCGAGATCATGG + Intergenic
915387743 1:155511870-155511892 GTTGTGGTGAGCCGAGATCCCGG - Intronic
916141434 1:161702648-161702670 GTTGCAGTGAGCCGAGATCACGG + Intergenic
916726942 1:167532126-167532148 GTTGCAGTGAGCCGAGATCGCGG - Intronic
917591593 1:176481764-176481786 AGTGCAGTGAGCCGAGATCGCGG - Intronic
917880320 1:179329275-179329297 GTTGCAGTGAGCCGAGATCATGG + Intronic
919055117 1:192561189-192561211 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
919403523 1:197148272-197148294 GTTGCAGTGAGCCGAGATCATGG + Intergenic
919728541 1:200898915-200898937 GTTGCAGTGAGCCGAGATCGCGG + Intronic
920014696 1:202897295-202897317 GTTGTGGTGAGCCGAGATCATGG - Intronic
921828070 1:219696074-219696096 GTTGCAGTGAGCCGAGATCAAGG + Intronic
921854851 1:219970714-219970736 GTTGCAGTGAGCCGAGATCACGG + Intronic
921861643 1:220047538-220047560 GTTGCGGTGAGCCGAGATCGCGG + Intergenic
922293877 1:224231963-224231985 GTTGCAGTGAGCCGAGATCGCGG + Intronic
922600607 1:226848910-226848932 GTTGCGGTGAGCCGAGATCGCGG + Intergenic
923308284 1:232708881-232708903 GTTGTGGTGAGCCGAGATCACGG - Intergenic
923664621 1:235989116-235989138 GTTGCAGTGAGCTGAGATCCTGG - Intronic
923789958 1:237103628-237103650 GTTGCAGTGAGCCGAGATCATGG - Intronic
923895348 1:238263573-238263595 GCTGCAGTGAGCCGAGATCACGG - Intergenic
924169820 1:241326846-241326868 GCTGCGGTGAGCTGAGATCATGG + Intronic
1062879671 10:967760-967782 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1064037169 10:11923775-11923797 GTTGCAGTGAGCCGAGATCCCGG + Intronic
1064376830 10:14804252-14804274 GTTACAGTGAGCCGAGATCGTGG - Intergenic
1064925264 10:20562535-20562557 CTTGCAGTGAGCCGAGATCCCGG + Intergenic
1064996937 10:21304170-21304192 GTTGCGGTGAGCAGAGATCATGG + Intergenic
1065072560 10:22041167-22041189 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1065346416 10:24752296-24752318 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1065870604 10:29953049-29953071 GTTTCAGTGAGCCGAGATCGTGG + Intergenic
1066213317 10:33261796-33261818 GTTGCAGTGAGCCGAGATCATGG - Intronic
1066683864 10:37961857-37961879 GTTGTGGTGAGCCGAGATCATGG + Intronic
1067106862 10:43372344-43372366 GTTGCAGTGAGCCGAGATCCTGG - Intronic
1067163940 10:43849838-43849860 GGTCCCCTGAGCCCAGTTCCTGG - Intergenic
1069481243 10:68784275-68784297 GTTGCAGTGAGCCGAGATCACGG - Intronic
1069835533 10:71305725-71305747 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1070067178 10:73048323-73048345 GCTGCAGTGAGCCGAGATCAAGG - Intronic
1070612607 10:77943960-77943982 GTTGCGGTGAGCCAAGATCATGG - Intergenic
1071958082 10:90780473-90780495 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1072132043 10:92503778-92503800 GTTGCTGTGAGCCGAGATCATGG - Intronic
1072140320 10:92583805-92583827 GTTGCCGTGAGCCGAGATCATGG - Intergenic
1072983111 10:100116292-100116314 GTTGCTGTGAGCCAAGATCCTGG - Intergenic
1073163687 10:101424170-101424192 GTTGCAGTGAGCCGAGATCATGG + Intronic
1073334455 10:102695592-102695614 GTTGCGGTGAGCCAAGATCATGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074117382 10:110466665-110466687 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1074508138 10:114089117-114089139 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1074586216 10:114769279-114769301 GATGCAGTGAGCCGAGATCACGG + Intergenic
1075893067 10:125970739-125970761 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1075992642 10:126850643-126850665 GGTCCTGGGAGGCGTGATCCAGG - Intergenic
1077041737 11:527760-527782 GTTGCGGTGAGCCGAGATCGCGG - Intergenic
1077097920 11:807128-807150 GTTGCGGTGAGCTGAGATCTCGG + Intronic
1077366421 11:2163101-2163123 CGGCCGGGGAGCTGAGATCCAGG + Intergenic
1077630268 11:3806957-3806979 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1077964379 11:7112224-7112246 GCTGCAGTGAGCCTAGATCCTGG + Intergenic
1079932991 11:26587892-26587914 GTTGCAGTGAGCCGAGATCATGG + Intronic
1081367121 11:42248932-42248954 GTTGCAGTGAACCGAGATCCCGG + Intergenic
1083211240 11:61188106-61188128 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1083449842 11:62736173-62736195 GTTGCGGTGAGCCGAGATCCTGG + Intronic
1083856970 11:65397935-65397957 GTTGCAGTGAGCCGAGATCATGG - Intronic
1083959296 11:66005337-66005359 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1084431302 11:69112922-69112944 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1084439000 11:69160152-69160174 GGTCCAGTGAGCCAGAATCCTGG + Intergenic
1084481245 11:69421421-69421443 GTTGCGGTGAGCCGAGATTGTGG + Intergenic
1084525095 11:69692224-69692246 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1085591016 11:77760987-77761009 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1086208923 11:84294534-84294556 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1089436793 11:118475659-118475681 GTTGCAGTGAGCCGAGATCACGG + Intronic
1089557304 11:119321454-119321476 GGGCCGGGGAACCGAGACCCAGG - Intronic
1090755788 11:129789973-129789995 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1090769492 11:129907464-129907486 GTTGTGGTGAGCCGAGATCGCGG - Intronic
1091438883 12:497213-497235 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1092357457 12:7808560-7808582 CTTCCAGTGAGCCGAGATCATGG - Intergenic
1092361605 12:7841320-7841342 GTTGCAGTGAGCCGAGATCATGG - Intronic
1092362624 12:7849841-7849863 GTTGCAGTGAGCCGAGATCAGGG + Intronic
1092614842 12:10207619-10207641 GGTGCAGTGAGCCAAGATCGCGG - Intergenic
1092764995 12:11844891-11844913 GTTGCAGTGAGCCGAGATCACGG - Intronic
1092828673 12:12422537-12422559 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1093090231 12:14912341-14912363 GTTGCAGTGAGCCGAGATCCTGG - Intergenic
1093247367 12:16755904-16755926 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1093656607 12:21701966-21701988 GTTGTGGTGAGCCGAGATCGTGG - Intronic
1093691243 12:22111861-22111883 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1094059304 12:26296795-26296817 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1095452985 12:42350891-42350913 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1095456596 12:42392152-42392174 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1095756791 12:45776842-45776864 GTTGCAGTGAGCCGAGATCACGG - Intronic
1096054649 12:48641425-48641447 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1096317343 12:50579548-50579570 GTTGCAGTGAGCCGAGATCATGG + Intronic
1096342176 12:50810277-50810299 GTTGCAGTGAGCCGAGATCATGG - Intronic
1096376933 12:51120114-51120136 GGTGCAGTGAGCCGAGATCGTGG + Intronic
1096696897 12:53355040-53355062 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1096927105 12:55160149-55160171 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1097031182 12:56090580-56090602 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1097254642 12:57664532-57664554 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1097790480 12:63810399-63810421 GTTGCGGTGAGCCGAGATCATGG - Intergenic
1097823970 12:64155692-64155714 GTTGCGGTGAGCCGAGGTCGTGG - Exonic
1098211751 12:68173378-68173400 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1098279866 12:68851547-68851569 GTTGCAGTGAGCCGAGATCACGG + Exonic
1100516997 12:95338031-95338053 GTTGCGGTGAGCGGAGATCATGG - Intergenic
1100827514 12:98488753-98488775 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1101020389 12:100547780-100547802 GTTGCAGTGAGCCGAGATCACGG - Intronic
1101327404 12:103728211-103728233 GCTGCAGTGAGCCGAGATCATGG - Intronic
1101465150 12:104940855-104940877 GTTGCAGTGAGCCGAGATCATGG + Intronic
1102033183 12:109755388-109755410 GTTGCGGTGAGCCGAGATTGCGG - Intronic
1102099542 12:110267865-110267887 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1102158971 12:110753343-110753365 GTTGTGGTGAGCCAAGATCCTGG + Intergenic
1102339445 12:112110002-112110024 CTTGCAGTGAGCCGAGATCCCGG + Intergenic
1102341574 12:112125856-112125878 GGTCTGGTGAGCCGGGAAGCGGG + Exonic
1102479153 12:113208991-113209013 GTTGCAGTGAGCCGAGATCATGG - Intronic
1102656430 12:114485540-114485562 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1102893127 12:116576981-116577003 GTTGCAGTGAGCCAAGATCCTGG + Intergenic
1102896497 12:116602451-116602473 AGGCTGGTGAGCTGAGATCCAGG - Intergenic
1102901732 12:116644052-116644074 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1102973734 12:117191061-117191083 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1103045242 12:117730579-117730601 GATGCGGTGAGCCGAGATGGCGG - Intronic
1103290042 12:119838132-119838154 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1103311679 12:120014628-120014650 GTTGCAGTGAGCCGAGATCACGG + Intronic
1103436156 12:120926767-120926789 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1103451454 12:121032129-121032151 GTTGCAGTGAGCCGAGATCACGG + Intronic
1103477130 12:121227044-121227066 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1103529316 12:121589570-121589592 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1103768526 12:123301067-123301089 GTTGCGGTGAGCTGAGATCGTGG - Intronic
1104324510 12:127783750-127783772 GTTGCGGTGAGCCAAGATCGGGG - Intergenic
1104396835 12:128441326-128441348 TGTCCAGTGAGCCCAGATTCTGG + Intronic
1104819896 12:131670578-131670600 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1105035914 12:132920886-132920908 GTTGCAGTGAGCCGAGATCACGG - Intronic
1105380232 13:19880488-19880510 GTTGTGGTGAGCCGAGATCGCGG - Intergenic
1105550957 13:21395561-21395583 GTTCCAGTGAGCCAAGATCACGG - Intronic
1105688308 13:22809095-22809117 GTTGCGGTGAGCCGAGATTGCGG - Intergenic
1106086460 13:26546648-26546670 GTTGTGGTGAGCCGAGATCGCGG + Intergenic
1106134256 13:26962377-26962399 GGTCAGGGGAGCTGAAATCCAGG + Intergenic
1106621987 13:31379155-31379177 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1106747851 13:32722281-32722303 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1108078938 13:46712695-46712717 GTTCTGCTGAGCCGAAATCCTGG + Intronic
1108406872 13:50113204-50113226 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1109444343 13:62413503-62413525 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1110683701 13:78346990-78347012 GTTGTGGGGAGCCGAGATCCCGG - Intergenic
1111654000 13:91130194-91130216 GGTCAGGGGAGCCCAGAACCTGG + Intergenic
1112163886 13:96897009-96897031 GCTACAGTGAGCCGAGATCATGG + Intergenic
1112813649 13:103248525-103248547 GGTGAGGTGAGTCGAGTTCCTGG + Intergenic
1112892192 13:104251352-104251374 GGTGCGGTGAGCCGAGATTGCGG + Intergenic
1113310094 13:109122614-109122636 GTTGCGGTGAGCCAAGATCGTGG + Intronic
1114594463 14:23899129-23899151 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1115084393 14:29496218-29496240 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1117414488 14:55481040-55481062 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1117700816 14:58411599-58411621 GCTGCAGTGAGCCGAGATCGTGG - Intronic
1118835695 14:69476194-69476216 GTTGCAGTGAGCCGAGATCGAGG + Intergenic
1119844331 14:77817178-77817200 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1120790337 14:88574996-88575018 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1120868198 14:89313494-89313516 GTTGCAGTGAGCCGAGATCATGG + Intronic
1121346178 14:93137351-93137373 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1121576986 14:94996466-94996488 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1122039033 14:98969168-98969190 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1122336434 14:100991094-100991116 GTTGCGGTGAGCTGAGATCGTGG - Intergenic
1123907848 15:24938175-24938197 GTTGCAGTGAGCCGAGATCATGG - Intronic
1125640881 15:41230143-41230165 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1125688868 15:41580445-41580467 GTTGCAGTGAGTCGAGATCCCGG + Exonic
1125787867 15:42337998-42338020 GTTGCAGTGAGCCGAGATCACGG + Intronic
1126098037 15:45102918-45102940 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1126589892 15:50327835-50327857 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1126590585 15:50335832-50335854 GTTGCAGTGAGCCGAGATCATGG + Intronic
1126604917 15:50466531-50466553 GTTGCAGTGAGCCGAGATCACGG + Intronic
1126952696 15:53899624-53899646 GTTGCGGTGAGCCGAGATCCTGG - Intergenic
1127023967 15:54782020-54782042 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1127079634 15:55364239-55364261 AGTCCTGTGAGACGAGATCTAGG + Intronic
1127887395 15:63214351-63214373 GCTACAGTGAGCCGAGATCATGG - Intronic
1128204472 15:65838595-65838617 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1129643680 15:77410147-77410169 GTTCCAGTGAGCCGAGATCATGG - Intronic
1130955570 15:88624819-88624841 GTTGCAGTGAGCCGAGATCACGG + Intronic
1131487066 15:92829669-92829691 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1131525654 15:93150470-93150492 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1132518166 16:375592-375614 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1132622427 16:874217-874239 GGGCCGGTGAGCCCAGCTCTGGG + Intronic
1133023850 16:2979270-2979292 GTTGCGGTGAGCCGAGATTGCGG + Intronic
1133065699 16:3205375-3205397 GGTGCAGTGAGCCAAGATCACGG - Intergenic
1133158599 16:3893459-3893481 GGTGCAGTGTGCCGAGATCATGG + Intergenic
1133224440 16:4334002-4334024 GTTGCAGTGAGCTGAGATCCGGG - Intronic
1133243297 16:4429283-4429305 GATGCGGTGAGCCGAGATCACGG - Intronic
1133248514 16:4464967-4464989 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1134152194 16:11813693-11813715 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1134205072 16:12230906-12230928 GTTGCAGTGAGCCGAGATCATGG - Intronic
1134369456 16:13609464-13609486 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1134398679 16:13889143-13889165 GTTGCAGTGAGCCGAGATCAAGG - Intergenic
1134515475 16:14883396-14883418 GTTGCAGTGAGCCGAGATCACGG - Intronic
1134703148 16:16282040-16282062 GTTGCAGTGAGCCGAGATCACGG - Intronic
1134964395 16:18430074-18430096 GTTGCAGTGAGCCGAGATCACGG + Intronic
1134968682 16:18512610-18512632 GTTGCAGTGAGCCGAGATCACGG + Intronic
1135354443 16:21757678-21757700 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1135452934 16:22573818-22573840 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1135950915 16:26913471-26913493 GTTACAGTGAGCCGAGATCGCGG - Intergenic
1136427929 16:30181769-30181791 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1136611001 16:31364955-31364977 GTTGTGGTGAGCCGAGATCGCGG + Intronic
1138380629 16:56599550-56599572 GGTGCAGTGAGCCAAGATCATGG - Intergenic
1138903458 16:61302298-61302320 GGTCTGGTCAGCTGAGATCAAGG - Intergenic
1139333713 16:66215741-66215763 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1139722824 16:68870840-68870862 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1140066745 16:71617643-71617665 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1140237174 16:73170290-73170312 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1140659940 16:77179534-77179556 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1142020577 16:87779672-87779694 GTTGCGGTGAGCCGAGGTCGTGG - Intergenic
1142402420 16:89867204-89867226 GTTGCAGTGAGCCGAGATCATGG - Intronic
1142489468 17:268938-268960 CTTGCGGTGAGCCGAGATCGCGG - Intronic
1142669042 17:1479054-1479076 GTTGCAGTGAGCCGAGATCACGG - Intronic
1142739409 17:1922038-1922060 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1142933014 17:3303828-3303850 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1143131279 17:4679086-4679108 GGTGCAGTGAGCTGAGATCGTGG - Intronic
1143388754 17:6547795-6547817 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1143463436 17:7119227-7119249 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1143626596 17:8113961-8113983 GTTGCGGTGAGCCGAGATCGCGG + Intronic
1143742064 17:8961571-8961593 GTTGCAGTGAGCCGAGATCACGG + Intronic
1143873583 17:9975291-9975313 GCTGCAGTGAGCCAAGATCCTGG + Intronic
1144569691 17:16388957-16388979 GTTGCAGTGAGCCGAGATCAGGG + Intergenic
1145361891 17:22219061-22219083 GTTGCAGTGAGCCGAGATCAGGG + Intergenic
1146114069 17:30118808-30118830 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1146361066 17:32178251-32178273 GTTGCAGTGAGCCGAGATCACGG - Intronic
1146368649 17:32249929-32249951 GCTGCAGTGAGCCGAGATCAAGG - Intronic
1147942464 17:44058768-44058790 GTTGCAGTGAGCCGAGATCACGG + Intronic
1148250740 17:46077617-46077639 GTTGCAGTGAGCCGAGATCATGG - Intronic
1148540348 17:48475393-48475415 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1148570023 17:48660933-48660955 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1149717349 17:58805310-58805332 GATGAGGTGAGCCGAGATCGCGG - Intronic
1149823157 17:59799899-59799921 GTTACAGTGAGCTGAGATCCTGG + Intronic
1149968589 17:61193198-61193220 GTTGCAGTGAGCCGAGATCATGG + Intronic
1150052031 17:61973919-61973941 GTTGCAGTGAGCCGAGATCATGG + Intronic
1150263128 17:63812961-63812983 GTTGCAGTGAGCCGAGATCATGG + Intronic
1150263140 17:63813091-63813113 GGTTTGGTGAGCTGAGATACAGG - Intronic
1150724648 17:67641736-67641758 GCTGCAGTGAGCTGAGATCCCGG + Intronic
1151614466 17:75199725-75199747 GTTGCAGTCAGCCGAGATCCTGG - Intergenic
1153036899 18:772088-772110 GTTGCCGTGAGCCGAGATCGTGG - Intronic
1153370099 18:4305470-4305492 GCTGCAGTGAGCCGAGATCGTGG + Intronic
1154003714 18:10507344-10507366 GCTGCAGTGAGCCGAGATCATGG + Intergenic
1154148932 18:11890369-11890391 GTTCCAGTGAGCCAAGATCATGG - Intronic
1155146649 18:23089359-23089381 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1155217120 18:23653310-23653332 GTTACAGTGAGCCGAGATCATGG - Intronic
1155478581 18:26261260-26261282 CTTGCAGTGAGCCGAGATCCCGG - Intronic
1157246178 18:46057040-46057062 GTTGCAGTGAGCCGAGATCAGGG + Intronic
1157255802 18:46138225-46138247 GTTGCAGTGAGCCGAGATCTTGG - Intergenic
1157871544 18:51234174-51234196 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1158461201 18:57647803-57647825 GTTCCAGTGAGCCGAGATCGTGG - Exonic
1158986614 18:62824068-62824090 GTTGCAGTGAGCCGAGATCATGG + Intronic
1160265752 18:77339799-77339821 GGTCCAGGGAGCTGCGATCCAGG - Intergenic
1160774161 19:847373-847395 GTTGCAGTGAGCCGAGATCACGG + Intronic
1161053404 19:2177356-2177378 GTTACAGTGAGCCGAGATCGCGG - Intronic
1161178489 19:2863238-2863260 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1161385116 19:3987467-3987489 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1161463947 19:4416827-4416849 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1161764256 19:6197876-6197898 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1161796607 19:6390483-6390505 CTTGCAGTGAGCCGAGATCCTGG + Intronic
1162202232 19:9029015-9029037 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1162356822 19:10191049-10191071 GTTGCAGTGAGCCGAGATCACGG + Intronic
1162755540 19:12857143-12857165 GTTGTGGTGAGCCGAGATCGTGG - Intronic
1162764689 19:12911677-12911699 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1163946752 19:20544064-20544086 GTTGCAGTGAGCCGAGATCATGG + Exonic
1163958934 19:20669211-20669233 GTTGCAGTAAGCCGAGATCCTGG - Intronic
1164006404 19:21153776-21153798 GTTGCGGTGAGCCAAGATCACGG - Intronic
1164050133 19:21578985-21579007 GTTTCAGTGAGCCGAGATCACGG - Intergenic
1165190371 19:34058095-34058117 GTTGCGGTGAGCTGAGATCATGG - Intergenic
1165504538 19:36216995-36217017 GCTGCAGTGAGCAGAGATCCTGG + Intronic
1165672991 19:37695195-37695217 GTTGCAGTGAGCCGAGATCATGG + Intronic
1166089471 19:40498761-40498783 GTTGCTGTGAGCCGAGATCATGG - Intronic
1166659540 19:44637345-44637367 GTTTCAGTGAGCCGAGATCATGG + Intergenic
1166722477 19:45004803-45004825 GTTGCCGTGAGCCGAGATCATGG + Intronic
1167043087 19:47034250-47034272 GGTACAGTGAGCCGAGATCGTGG + Intronic
1167135791 19:47614553-47614575 GTTGCGGTGAGCCGAGATTGCGG + Intronic
1167232657 19:48295192-48295214 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1167282086 19:48575540-48575562 GTTGCAGTGAGCCGAGATCACGG - Intronic
1167872129 19:52379455-52379477 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1168265050 19:55218627-55218649 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1168454172 19:56492967-56492989 GTTGCAGTGAGCCGAGATCACGG - Intergenic
925205034 2:1998262-1998284 GGTCAAGTGAGCAGAGAGCCCGG + Intronic
926661978 2:15477321-15477343 GTTGCAGTGAGCCGAGATCGCGG - Intronic
927592696 2:24370410-24370432 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
927709812 2:25317795-25317817 GTTGCGGTGAGCCGAGATCGCGG - Intronic
928554080 2:32404721-32404743 GGTGCAGTGAGCCGTGAGCCCGG - Intronic
928959614 2:36910109-36910131 GCTGCAGTGAGCCGAGATCGTGG + Intronic
929050795 2:37835066-37835088 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
929502174 2:42499724-42499746 GTTGCGGTGAGCTGAGATCAAGG + Intronic
930108878 2:47661006-47661028 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
931677262 2:64709772-64709794 GTTGCAGTGAGCCGAGATCGTGG - Intronic
934783431 2:96987318-96987340 GTTGCAGTGAGCCGAGATCGTGG + Intronic
935228268 2:101073354-101073376 GTTGCAGTGAGCCGAGATCGTGG - Intronic
936280790 2:111138068-111138090 GGTGCAGTGAGCTGAGATCATGG - Intronic
936376478 2:111945712-111945734 GGCCAGGTGAGCCCAGGTCCTGG + Intronic
938253282 2:129833091-129833113 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
940148327 2:150571886-150571908 GTTGCAGTGAGCCGAGATCATGG + Intergenic
940471603 2:154107526-154107548 GTTGCAGTGAGCCGAGATCATGG + Intronic
940768898 2:157819416-157819438 GTTACGGTGAGCCGAGATCACGG + Intronic
940817438 2:158311396-158311418 GTTGCAGTGAGCCGAGATCGCGG + Intronic
941598060 2:167502975-167502997 GTTGCAGTGAGCCGAGATCACGG + Intergenic
941874181 2:170416885-170416907 GTTGCAGTGAGCCGAGATCGCGG - Intronic
941940323 2:171029806-171029828 GGTGCAGTGAGCTGAGATCGTGG - Intronic
942462446 2:176177881-176177903 GGTCTGGTGAGCTGAGCTCTAGG + Intergenic
943332039 2:186571525-186571547 GTTGCAGTGAGCCGAGAGCCTGG - Intergenic
943354102 2:186830318-186830340 GTTGCAGTGAGCCGAGATCACGG + Intronic
943839584 2:192561842-192561864 GTTCCGGTGAGGTGAGATTCTGG + Intergenic
944212521 2:197221187-197221209 GTTGCAGTGAGCCGAGATCATGG + Intronic
945685627 2:212966127-212966149 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
945894581 2:215467520-215467542 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
946011808 2:216571012-216571034 GTTGCAGTGAGCCGAGATCACGG + Intronic
946678857 2:222192170-222192192 GTTGCAGTGAGCCGAGATCATGG + Intergenic
947283064 2:228478207-228478229 GTTGTGGTGAGCCGAGATCGTGG - Intergenic
947505995 2:230708863-230708885 GTTGCCGTGAGCCGAGATCGCGG - Intergenic
948038426 2:234878974-234878996 GTTGCGGTGAGCCGAGATTGCGG + Intergenic
1169904906 20:10592694-10592716 GTTGCAGTGAGCCGAGATCATGG - Intronic
1170072335 20:12382099-12382121 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1170192971 20:13662004-13662026 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1170393700 20:15903278-15903300 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1171292682 20:23991332-23991354 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1172239967 20:33406564-33406586 GTTGCGGTGAGCTGAGATCGCGG - Intergenic
1172259077 20:33546491-33546513 GTTGCAGTGAGCCGTGATCCTGG - Intronic
1172531876 20:35636727-35636749 GTTGCAGTGAGCCGAGATCATGG + Intronic
1172663145 20:36581063-36581085 GTTGCGGTGAGCCGAGATGGTGG + Intronic
1172738865 20:37150358-37150380 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1173473149 20:43338954-43338976 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1173591805 20:44230692-44230714 GTTACAGTGAGCCGAGATCCCGG + Intergenic
1173674366 20:44821088-44821110 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1173913538 20:46689110-46689132 GGTAAGGTGGGCCGGGATCCCGG - Exonic
1173987528 20:47273482-47273504 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1174205224 20:48833501-48833523 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1174222521 20:48968462-48968484 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1176162004 20:63652942-63652964 CGTCCGGCGACCCGAGATCTGGG - Intronic
1177586951 21:23109481-23109503 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1179709656 21:43205958-43205980 GTTGCAGTGAGCCAAGATCCTGG + Intergenic
1179781856 21:43706196-43706218 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1180296404 22:10941041-10941063 GTTGCGATGAGCCGAGATCATGG + Intergenic
1180412271 22:12624961-12624983 GATGCGATGAGCCGAGATCATGG - Intergenic
1180767974 22:18357828-18357850 GTTGCAGTGAGCCGAGATCTCGG + Intergenic
1180778333 22:18504562-18504584 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1180811056 22:18761871-18761893 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1180823744 22:18849092-18849114 GTTGCAGTGAGCCGAGATCTCGG - Intronic
1180878754 22:19188671-19188693 GATGCAGTGAGCCGAGATCACGG - Intronic
1181124165 22:20692196-20692218 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1181151562 22:20887161-20887183 GTTGCAGTGAGCCGAGATCATGG + Intronic
1181197205 22:21196126-21196148 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1181380277 22:22496877-22496899 GTTGCAGTGAGCCGAGATCACGG - Intronic
1181399313 22:22641905-22641927 GTTGCAGTGAGCCGAGATCTCGG + Intergenic
1181647072 22:24237468-24237490 GTTGCAGTGAGCCGAGATCGAGG - Intronic
1181650104 22:24254163-24254185 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
1181929963 22:26392917-26392939 GTTGCGGTGAGCCGAGATCGCGG - Intergenic
1183280545 22:36929741-36929763 CGTCCTGAGAGCCGAGAACCTGG - Exonic
1183525916 22:38322631-38322653 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1183592911 22:38791413-38791435 GTTGCAGTGAGCCGAGATCACGG - Intronic
1183938188 22:41276575-41276597 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1183967735 22:41452825-41452847 GTTCCAGTGAGCCAAGATCACGG + Intergenic
1184387469 22:44184398-44184420 GCTGCAGTGAGCCGAGATCCTGG - Intronic
1184484896 22:44771306-44771328 GTTGCAGTGAGCCGAGATCATGG - Intronic
1184511793 22:44938134-44938156 GTTGCAGTGAGCCGAGATCGAGG - Intronic
1184700078 22:46165095-46165117 GTTGCAGTGAGCCGAGATCATGG - Intronic
1184796671 22:46737228-46737250 GGTGCAGTGAGCCAAGATCGTGG + Intronic
1185124127 22:48995534-48995556 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1185266062 22:49904799-49904821 GTTGCAGTGAGCCGAGATCATGG - Intronic
1203216740 22_KI270731v1_random:10393-10415 GTTGCAGTGAGCCGAGATCTCGG + Intergenic
1203229593 22_KI270731v1_random:98710-98732 GTTGCAGTGAGCCGAGATCTCGG + Intergenic
1203273888 22_KI270734v1_random:74996-75018 GTTGCAGTGAGCCGAGATCTCGG - Intergenic
949502366 3:4693060-4693082 GTTGTGGTGAGCCGAGATCACGG + Intronic
950020324 3:9782727-9782749 GTTGCAGTGAGCCGAGATCATGG + Intronic
951234296 3:20216638-20216660 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
951661021 3:25066861-25066883 AGACCGGTGAGCCAAGATACAGG - Intergenic
953084736 3:39655363-39655385 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
953331112 3:42053593-42053615 GGTCCTCTGGGCCTAGATCCTGG - Intronic
953942422 3:47112173-47112195 GTTGCAGTGAGCCGAGATCATGG - Intronic
954018785 3:47719795-47719817 GTTGCAGTGAGCCGAGATCATGG - Intronic
954675371 3:52312530-52312552 GTTCCAGTGAGCCGAGATCGTGG - Intergenic
954901218 3:54021664-54021686 GTTGCAGTGAGCCAAGATCCTGG + Intergenic
955339373 3:58113232-58113254 GGTCTGGAGAGCAGACATCCTGG + Intronic
955358130 3:58248634-58248656 GTTGCGGTGAGCTGAGATCGCGG + Intronic
955626698 3:60927070-60927092 GTTGCAGTGAGCCGAGATCGTGG - Intronic
956239832 3:67117157-67117179 GTTGCAGTGAGCCGAGATCATGG + Intergenic
956415699 3:69026528-69026550 GTTGCGGTGAGCCGAGATAGCGG + Intronic
956835683 3:73094536-73094558 GTTGCAGTGAGCCGAGATCTGGG - Intergenic
958416775 3:93883530-93883552 GTTGCGGTGAGCCGAGATTGTGG + Intronic
958431231 3:94043717-94043739 GTTGCAGTGAGCCGAGATCATGG - Intronic
959699765 3:109287687-109287709 GTTGAAGTGAGCCGAGATCCTGG + Intergenic
960608094 3:119528861-119528883 GGTGCAGTGAGCTGAGATCGGGG + Intronic
961518081 3:127450896-127450918 GGGCCGGTGTGCTGAGATCATGG - Intergenic
961771762 3:129255238-129255260 GTTGCAGTGAGCCGAGATCGTGG - Intronic
962761676 3:138520879-138520901 GTTGCAGTGAGCCGAGATCGCGG - Intronic
965136812 3:164784004-164784026 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
966183824 3:177210775-177210797 GTTGCAGTGAGCCGAGATCACGG - Intergenic
966800907 3:183762987-183763009 GTTGCGGTGAGCTGAGATCGCGG + Intronic
966814680 3:183880461-183880483 GTTGCAGTGAGCCGAGATCACGG - Intronic
966844729 3:184119572-184119594 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
966944209 3:184766305-184766327 GTTCTAGTGAGCCGAGATCACGG - Intergenic
967027605 3:185578430-185578452 GGTGCGGTGAGTGGAGATCGCGG - Intergenic
967038819 3:185670628-185670650 GTTACGGTGAGCTGAGATCGTGG - Intronic
967164289 3:186766854-186766876 GCTGCAGTGAGCCGAGATCTGGG - Intergenic
967228773 3:187318242-187318264 GTTGCAGTGAGCTGAGATCCCGG - Intergenic
967526976 3:190506279-190506301 GTTGCAGTGAGCCGAGATCACGG + Intergenic
968972111 4:3801416-3801438 GGCCCCGTGTGCCGAGTTCCAGG + Intergenic
972655058 4:41056116-41056138 GTTGCAGTGAGCCGAGATCGCGG + Intronic
972668387 4:41190311-41190333 GTTGCAGTGAGCCGAGATCGCGG - Intronic
972825727 4:42757025-42757047 GTTGCTGTGAGCCGAGATCACGG - Intergenic
974597724 4:64036716-64036738 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
974879260 4:67733862-67733884 GTTGCGGTGAGCCGAGATAGTGG + Intergenic
975108484 4:70596216-70596238 GTTGCAGTGAGCCGAGATCACGG + Intronic
975174122 4:71267730-71267752 GTTGCAGTGAGCCGAGATCATGG + Intronic
975324626 4:73045260-73045282 GTTGCAGTGAGCCGAGATCACGG + Intergenic
976194451 4:82519485-82519507 GTTGCAGTGAGCCGAGATCTTGG - Intronic
977295722 4:95206719-95206741 GGGCGGGTGAGCAGAGCTCCTGG + Exonic
977542299 4:98331221-98331243 GTTGCAGTGAGCCGAGATCACGG + Intronic
978128093 4:105159315-105159337 GTTGCAGTGAGCCGAGATCGCGG - Intronic
978334866 4:107656175-107656197 GGTGTGGTGAGCCAAGATCATGG - Intronic
979049799 4:115916353-115916375 GTTGCGGTGAGCTGAGATCATGG - Intergenic
979516222 4:121613208-121613230 GCTGCAGTGAGCCGAGATCACGG - Intergenic
979702373 4:123684388-123684410 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
980132952 4:128833630-128833652 GTTGCAGTGAGCCGAGATCGTGG + Intronic
980281622 4:130730286-130730308 GTTCCAGTGAGCCAAGATCGTGG + Intergenic
980911239 4:138996717-138996739 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
981132488 4:141172962-141172984 GGTGCAGTGAGCCAAGATCGCGG + Intronic
981308804 4:143275502-143275524 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
981314083 4:143324699-143324721 GTTGCAGTGAGCCGAGATCGAGG - Intergenic
981712789 4:147725533-147725555 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
982620519 4:157697880-157697902 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
983149411 4:164259480-164259502 GTTGCGGTGAGCTGAGATCACGG + Intronic
983211999 4:164968088-164968110 GTTGCAGTGAGCCGAGATCCTGG + Intronic
983226449 4:165090147-165090169 GTTGCGGTGAGCCAAGATCGTGG + Intronic
983399746 4:167247451-167247473 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
983498365 4:168470776-168470798 GTTGCAGTGAGCCGAGATCACGG + Intronic
983517579 4:168673974-168673996 GTTGCAGTGAGCCGAGATCGCGG - Intronic
983932062 4:173463333-173463355 GTTGCAGTGAGCCGAGATCACGG - Intergenic
984091097 4:175376298-175376320 GCTGCAGTGAGCCGAGATCGCGG + Intergenic
984767776 4:183412737-183412759 GTTGTGGTGAGCCGAGATCGCGG + Intergenic
984775394 4:183477461-183477483 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
984796273 4:183663126-183663148 GCTCCAGTGAGCCAAGATCACGG - Intronic
984902031 4:184594028-184594050 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
985251967 4:188033103-188033125 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
985630328 5:1010624-1010646 GGTCCTGTGAGCCTCTATCCGGG + Intronic
987555385 5:19440276-19440298 GCTGCAGTGAGCCGAGATCACGG - Intergenic
987702325 5:21416417-21416439 GTTCCAGTGAGCCAAGATCGCGG + Intergenic
988679233 5:33468653-33468675 GTTGCAGTGAGCCGAGATCATGG - Intronic
989049068 5:37300883-37300905 GTTTCAGTGAGCCGAGATCATGG - Intronic
989546405 5:42679561-42679583 GTTGCAGTGAGCCGAGATCATGG + Intronic
989584736 5:43066033-43066055 GTTGCAGTGAGCCGAGATCGCGG + Intronic
989741527 5:44779175-44779197 GTTGCAGTGAGCCGAGATCATGG + Intergenic
989991915 5:50775491-50775513 GTTGCGGCGAGCCGAGATCAAGG + Intronic
990547759 5:56840207-56840229 GTTGCAGTGAGCCGAGATCAGGG - Intronic
990849189 5:60182568-60182590 GTTGCAGTGAGCTGAGATCCCGG + Intronic
992215229 5:74518964-74518986 GTTGCAGTGAGCCGAGATCATGG + Intergenic
992540603 5:77760482-77760504 GTTGCAGTGAGCCGAGATCACGG - Intronic
992789103 5:80197899-80197921 GCTGCAGTGAGCCGAGATCCCGG - Intronic
992960229 5:81950631-81950653 GTTGCAGTGAGCCAAGATCCTGG + Intergenic
993584194 5:89702862-89702884 GTTGCAGTGAGCCGAGATCATGG - Intergenic
993649793 5:90506165-90506187 GTTGCTGTGAGCCGAGATCGTGG + Intronic
995456705 5:112360344-112360366 GTTGCGGTGAGCCGAGATGGCGG - Intronic
995679491 5:114701040-114701062 TGTCCTGTGAGCTGAGACCCTGG - Intergenic
996388430 5:122933842-122933864 GGTGTGGTGAGCAGAGATCGTGG - Intronic
996601428 5:125268547-125268569 GTTGAAGTGAGCCGAGATCCTGG + Intergenic
996737038 5:126767605-126767627 GTTGCAGTGAGCCGAGATCATGG - Intergenic
997433709 5:133858771-133858793 GGTGCAGCGAGCCGAGATCACGG + Intergenic
997553594 5:134775471-134775493 GTTGCAGTGAGCCGAGATCACGG - Intronic
998101094 5:139435289-139435311 GTTGCAGTGAGCCGAGATCGTGG + Intronic
998261313 5:140633849-140633871 GTTGCAGTGAGCCGAGATCATGG - Intergenic
999462506 5:151770052-151770074 GTTGCAGTGAGCCGAGATCACGG + Exonic
999978908 5:156940027-156940049 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1000058615 5:157632546-157632568 AGTGCAGTGAGCCGAGATCGTGG + Intronic
1000221550 5:159219442-159219464 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1000843899 5:166255208-166255230 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1001957140 5:175855721-175855743 GGTCCAGTGAGACTCGATCCTGG - Intronic
1002630791 5:180575329-180575351 GATCTGGTGAGCAAAGATCCAGG - Exonic
1003285651 6:4731735-4731757 GTTGCAGTGAGCCGAGATGCAGG + Intronic
1003888525 6:10542967-10542989 GTTGCAGTGAGCCGAGATCATGG - Intronic
1004152332 6:13133364-13133386 GGTGCAGTGAGCCGAGATGGCGG - Intronic
1006292999 6:33154939-33154961 GTTGCGGTGAGCCAAGATCACGG - Intergenic
1006618792 6:35347967-35347989 GTTGCAGTGAGCCGAGATCACGG - Intronic
1006850680 6:37095947-37095969 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1007445057 6:41898666-41898688 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1007448316 6:41924120-41924142 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1007551506 6:42733372-42733394 GTTGCGGTGAGCCAAGATCGTGG + Intergenic
1007925918 6:45649630-45649652 GTTGCAGTGAGCCGAGATCATGG - Intronic
1008114936 6:47538301-47538323 GGTGCAGTGAGCCGAGATCATGG - Intronic
1008445914 6:51590609-51590631 GTTTCAGTGAGCCGAGATCCTGG - Intergenic
1008481082 6:51985665-51985687 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1008760445 6:54846852-54846874 GGTCCCGTCCGCCGAGGTCCGGG - Intronic
1008792807 6:55258987-55259009 GTTGCAGTGAGCCGAGATCATGG + Intronic
1009431266 6:63569315-63569337 GCTGCAGTGAGCCGAGATCATGG - Intronic
1010230582 6:73531144-73531166 ATTGCGGTGAGCCGAGATCACGG - Intergenic
1010230584 6:73531160-73531182 GTTGCGGTGAGCCGAGATTGCGG - Intergenic
1011002305 6:82604557-82604579 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1011581210 6:88867419-88867441 GTTGCAGTGAGCCGAGATCATGG + Intronic
1011685653 6:89821415-89821437 GTTGTGGTGAGCCGAGATCGTGG + Intergenic
1012482622 6:99684223-99684245 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1012891948 6:104906849-104906871 GTTGCAGTGAGCCGAGATCGTGG + Intergenic
1013121722 6:107147229-107147251 GTTGCAGTGAGCCGAGATCCTGG + Intergenic
1014218039 6:118772078-118772100 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1014987119 6:128024746-128024768 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1015176612 6:130316227-130316249 GTTGCAGTGAGCCGAGATCATGG + Intronic
1015227413 6:130873525-130873547 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1015268090 6:131308972-131308994 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1015595990 6:134867660-134867682 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1015870915 6:137775641-137775663 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1017648943 6:156563582-156563604 GTTGCAGTGAGCCGAGATCGAGG + Intergenic
1019101103 6:169630830-169630852 GTTGCAGTGAGCCGAGATCATGG + Intronic
1020200521 7:6076339-6076361 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1020228074 7:6295983-6296005 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1020283401 7:6663297-6663319 GTTCCAGTGAGCTGAGATCGCGG - Intergenic
1021161437 7:17278104-17278126 GTTGCGGTGAGCCCAGATCGCGG - Intergenic
1021691712 7:23236492-23236514 GTTACGGTGAGCCGAGATCGTGG + Intronic
1021713316 7:23438179-23438201 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1023170568 7:37386695-37386717 GGTCGGGTAAGTAGAGATCCAGG + Intronic
1023785802 7:43706483-43706505 GCTGCAGTGAGCCGAGATCATGG + Intronic
1023895774 7:44431732-44431754 GTTGCAGTGAGCCGAGATCGTGG - Intronic
1023954405 7:44872537-44872559 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1024298809 7:47868811-47868833 GTTGCAGTGAGCCGAGATCACGG + Intronic
1024476932 7:49822493-49822515 GTTGCAGTGAGCTGAGATCCTGG - Intronic
1025193737 7:56916387-56916409 GCTGCAGTGAGCCGAGATCATGG + Intergenic
1025243783 7:57300164-57300186 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1025678206 7:63660554-63660576 GCTGCAGTGAGCCGAGATCATGG - Intergenic
1025857078 7:65290648-65290670 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1026167456 7:67922922-67922944 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1026700984 7:72644887-72644909 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1027788176 7:82606461-82606483 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1028156818 7:87439448-87439470 GGTGCAGTGAGCCCAGATCCAGG - Intronic
1028352700 7:89868454-89868476 GTTGCAGTGAGCCGAGATCAAGG + Intergenic
1028535486 7:91886945-91886967 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1029297875 7:99555842-99555864 GTTGCAGTGAGCCGAGATCACGG + Intronic
1029960280 7:104683049-104683071 GTTGCAGTGAGCCGAGATCACGG - Intronic
1030028731 7:105349798-105349820 GTTGCGGTGAGCTGAGATCACGG - Intronic
1030065848 7:105658590-105658612 GTTGCGGCGAGCCAAGATCCTGG - Intronic
1030723919 7:112902352-112902374 GTTGCGGTGAGCTGAGATCGCGG + Intronic
1032363234 7:131275428-131275450 GTTGCAGTGAGCCGAGATCATGG - Intronic
1032834192 7:135658376-135658398 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1032946586 7:136860533-136860555 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1033040679 7:137914953-137914975 GCTGCAGTGAGCCGAGATCGAGG - Intronic
1034092320 7:148375419-148375441 GTTGCAGTGAGCCGAGATCACGG - Intronic
1034301637 7:150020880-150020902 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1034630886 7:152529803-152529825 GTTGCGGTGAGCCAAGATCCAGG - Intergenic
1034745718 7:153522076-153522098 GGTGCAGTGAGCCAAGATCGCGG + Intergenic
1035171137 7:157018049-157018071 GGCCCGCTGAGCCGGGAGCCGGG + Intergenic
1035185359 7:157121902-157121924 GGTGCAGTGAGCCAAGATCATGG - Intergenic
1035742600 8:1939488-1939510 GGCACAGTGAGCCGAAATCCAGG + Intronic
1035866073 8:3083715-3083737 GCTGCAGTGAGCCGAGATCACGG - Intronic
1037184585 8:16047379-16047401 GGTGCAGTGAGCCGAGATTGTGG + Intergenic
1038563152 8:28597907-28597929 GTTGCAGTGAGCCGAGATCGCGG - Intergenic
1038624960 8:29183211-29183233 GTTACAGTGAGCTGAGATCCTGG - Intronic
1039054262 8:33522155-33522177 GTTGCGGTGAGCCAAGATCAAGG + Intergenic
1039930234 8:41979935-41979957 GCTGCAGTGAGCCAAGATCCTGG + Intronic
1039968715 8:42303564-42303586 GTTGCAGTGAGCCGAGATCATGG - Intronic
1041078391 8:54189711-54189733 GTTGCGGTGAGCTGAGATCATGG + Intergenic
1041162661 8:55060967-55060989 GTTGCAGTGAGCCAAGATCCTGG + Intergenic
1042139096 8:65661565-65661587 GTTGCAGTGAGCCAAGATCCTGG + Intronic
1044673933 8:94711125-94711147 GGTGCAGTGAGCCGAGGTCGCGG - Intergenic
1046864319 8:119129140-119129162 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1047479086 8:125263686-125263708 GTTGCAGTGAGCCGAGATCATGG + Intronic
1049481766 8:142827734-142827756 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1049696841 8:143988209-143988231 GTTGCAGTGAGCCGAGATCACGG - Intronic
1049724782 8:144140674-144140696 GGGCAGGTGAGAGGAGATCCTGG - Exonic
1050637344 9:7626290-7626312 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1050962405 9:11751505-11751527 GTTGCAGTGAGCCGAGAGCCTGG + Intergenic
1051277218 9:15408026-15408048 GTTGCAGTGAGCCGAGATCGAGG + Intergenic
1052818455 9:33120120-33120142 GTTGCGGTGAGCCAAGATCACGG + Intronic
1052833946 9:33236467-33236489 GGTCAGGGGAGCAGAGATCAAGG + Intronic
1053018740 9:34679651-34679673 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1053197313 9:36129439-36129461 GTTACAGTGAGCCGAGATCACGG - Intergenic
1053246744 9:36540898-36540920 GTTGTGGTGAGCCGAGATCAAGG - Intergenic
1053370142 9:37553852-37553874 GTTGCGGTGAGCCGAGATCATGG + Intronic
1053747690 9:41216732-41216754 GTTGCGATGAGCCGAGATCATGG - Intergenic
1054338698 9:63833782-63833804 GTTGCGATGAGCCGAGATCGTGG + Intergenic
1054479594 9:65648638-65648660 GTTGCGATGAGCCGAGATCATGG + Intergenic
1055061140 9:72070066-72070088 GTTGCAGTGAGCCGAGATCATGG + Intronic
1055066668 9:72125976-72125998 GTTGCAGTGAGCCGAGATCATGG - Intronic
1056241701 9:84654137-84654159 GTTGCAGTGAGGCGAGATCCCGG + Intergenic
1056621465 9:88218242-88218264 GTTGCAGTGAGCCGAGATCGTGG - Intergenic
1056862796 9:90202621-90202643 GGTGCAGTGAGCCGAGATCGTGG + Intergenic
1057579004 9:96268885-96268907 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1057614676 9:96578878-96578900 GTTGCAGTGAGCCGAGATCGCGG - Intronic
1057763785 9:97898391-97898413 GCTACAGTGAGCCGAGATCATGG - Intergenic
1058001685 9:99872404-99872426 GTTGTGGTGAGCCGAGATCGTGG - Intergenic
1058667813 9:107336662-107336684 GCTCCAGTGAGCCGAGATCACGG + Intergenic
1059318784 9:113450129-113450151 GTTGCAGTGAGCCGAGATCACGG - Intronic
1060650734 9:125324525-125324547 GTTGCGGTGAGCCAAGATCGTGG + Intronic
1061026515 9:128053205-128053227 GTTGCGGTGAGCCGAGATCATGG + Intergenic
1061197181 9:129112877-129112899 GTTGCGGTGAGCTGAGATCGCGG + Intronic
1061206451 9:129166698-129166720 GTTTCGGTGAGCTGAGATCCTGG + Intergenic
1061265503 9:129502644-129502666 CTTGCGGTGAGCCGAGATCGGGG - Intergenic
1062335963 9:136067771-136067793 GTTGCGGTGAGCCGAGATCGCGG + Intronic
1202783824 9_KI270718v1_random:27503-27525 GTTGCGATGAGCCGAGATCATGG - Intergenic
1203448048 Un_GL000219v1:79284-79306 GTTGCGATGAGCCGAGATCATGG + Intergenic
1185557977 X:1036324-1036346 GTTGCGGTGAGCCAAGATCACGG + Intergenic
1185723009 X:2396824-2396846 GTTGTGGTGAGCCGAGATCGTGG - Intronic
1187373066 X:18726289-18726311 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1187541741 X:20203322-20203344 GTTGCTGTGAGCCGAGATCGTGG - Intronic
1187783736 X:22860226-22860248 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1188681997 X:33020610-33020632 GTTGCAGTGAGCCGAGATCATGG + Intronic
1188873753 X:35405175-35405197 GTTGCAGTGAGCCGAGATCACGG - Intergenic
1189354076 X:40298405-40298427 GCACCGGTGAGCCCAGCTCCTGG + Intergenic
1189816861 X:44832979-44833001 GTTGTGGTGAGCCGAGATCGTGG + Intergenic
1189882292 X:45504804-45504826 GTTGCAGTGAGCCGAGATCGCGG + Intergenic
1189914030 X:45839126-45839148 GTTGCTGTGAGCCGAGATCCCGG + Intergenic
1191175300 X:57493671-57493693 GTTGCAGTGAGCCGAGATCATGG + Intergenic
1191797810 X:65040844-65040866 GTTGCAGTGAGCCGAGATCATGG - Intergenic
1193522051 X:82542600-82542622 GTTGTGGTGAGCCGAGATCGTGG - Intergenic
1195682410 X:107558743-107558765 GTTGCAGTGAGCCGAGATCATGG - Intronic
1195703234 X:107720629-107720651 GTTGCAGTGAGCCGAGATCGTGG + Intronic
1196426735 X:115577537-115577559 GCTGCAGTGAGCCGAGATCACGG - Intronic
1197696429 X:129554888-129554910 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1197942872 X:131807628-131807650 GTTGCGGTGAGCCGAGATCATGG + Intergenic
1198215237 X:134549499-134549521 GGGACGGAGAGCCGAGAGCCGGG + Intergenic
1198243389 X:134806552-134806574 GTTGCAGTGAGCCGAGATCGCGG + Intronic
1198465623 X:136902242-136902264 GTTGCAGTGAGCCGAGATCACGG + Intergenic
1198751545 X:139940960-139940982 GTCGCAGTGAGCCGAGATCCTGG - Intronic
1199718258 X:150523075-150523097 GTTGCAGTGAGCCGAGATCGGGG - Intergenic
1199817307 X:151410272-151410294 GTTGCAGTGAGCCGAGAGCCTGG + Intergenic
1200036575 X:153334960-153334982 GGGGCGGTGAGCCGAGCTCAAGG + Intronic