ID: 912652136

View in Genome Browser
Species Human (GRCh38)
Location 1:111449078-111449100
Sequence AACTGCCGTTCCATGCAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652130_912652136 -4 Left 912652130 1:111449059-111449081 CCGGTACCGCGCAGCCTCCAACT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652129_912652136 1 Left 912652129 1:111449054-111449076 CCGGACCGGTACCGCGCAGCCTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652123_912652136 24 Left 912652123 1:111449031-111449053 CCCAGGCCCGGGATCTCGGCTCA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652126_912652136 18 Left 912652126 1:111449037-111449059 CCCGGGATCTCGGCTCACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652127_912652136 17 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652124_912652136 23 Left 912652124 1:111449032-111449054 CCAGGCCCGGGATCTCGGCTCAC 0: 1
1: 0
2: 3
3: 30
4: 479
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74
912652131_912652136 -10 Left 912652131 1:111449065-111449087 CCGCGCAGCCTCCAACTGCCGTT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 912652136 1:111449078-111449100 AACTGCCGTTCCATGCAGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912652136 Original CRISPR AACTGCCGTTCCATGCAGGC GGG Exonic