ID: 912652138

View in Genome Browser
Species Human (GRCh38)
Location 1:111449087-111449109
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652126_912652138 27 Left 912652126 1:111449037-111449059 CCCGGGATCTCGGCTCACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652132_912652138 -9 Left 912652132 1:111449073-111449095 CCTCCAACTGCCGTTCCATGCAG 0: 1
1: 0
2: 0
3: 13
4: 106
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652129_912652138 10 Left 912652129 1:111449054-111449076 CCGGACCGGTACCGCGCAGCCTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652131_912652138 -1 Left 912652131 1:111449065-111449087 CCGCGCAGCCTCCAACTGCCGTT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652130_912652138 5 Left 912652130 1:111449059-111449081 CCGGTACCGCGCAGCCTCCAACT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31
912652127_912652138 26 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652138 1:111449087-111449109 TCCATGCAGGCGGGCGCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type