ID: 912652140

View in Genome Browser
Species Human (GRCh38)
Location 1:111449088-111449110
Sequence CCATGCAGGCGGGCGCATTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652130_912652140 6 Left 912652130 1:111449059-111449081 CCGGTACCGCGCAGCCTCCAACT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652127_912652140 27 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652129_912652140 11 Left 912652129 1:111449054-111449076 CCGGACCGGTACCGCGCAGCCTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652131_912652140 0 Left 912652131 1:111449065-111449087 CCGCGCAGCCTCCAACTGCCGTT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652126_912652140 28 Left 912652126 1:111449037-111449059 CCCGGGATCTCGGCTCACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40
912652132_912652140 -8 Left 912652132 1:111449073-111449095 CCTCCAACTGCCGTTCCATGCAG 0: 1
1: 0
2: 0
3: 13
4: 106
Right 912652140 1:111449088-111449110 CCATGCAGGCGGGCGCATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912652140 Original CRISPR CCATGCAGGCGGGCGCATTT GGG Exonic