ID: 912652142

View in Genome Browser
Species Human (GRCh38)
Location 1:111449090-111449112
Sequence ATGCAGGCGGGCGCATTTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912652127_912652142 29 Left 912652127 1:111449038-111449060 CCGGGATCTCGGCTCACCGGACC 0: 1
1: 0
2: 2
3: 41
4: 591
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652134_912652142 -9 Left 912652134 1:111449076-111449098 CCAACTGCCGTTCCATGCAGGCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652131_912652142 2 Left 912652131 1:111449065-111449087 CCGCGCAGCCTCCAACTGCCGTT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652126_912652142 30 Left 912652126 1:111449037-111449059 CCCGGGATCTCGGCTCACCGGAC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652129_912652142 13 Left 912652129 1:111449054-111449076 CCGGACCGGTACCGCGCAGCCTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652132_912652142 -6 Left 912652132 1:111449073-111449095 CCTCCAACTGCCGTTCCATGCAG 0: 1
1: 0
2: 0
3: 13
4: 106
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
912652130_912652142 8 Left 912652130 1:111449059-111449081 CCGGTACCGCGCAGCCTCCAACT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 912652142 1:111449090-111449112 ATGCAGGCGGGCGCATTTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912652142 Original CRISPR ATGCAGGCGGGCGCATTTGG GGG Exonic