ID: 912654712

View in Genome Browser
Species Human (GRCh38)
Location 1:111476059-111476081
Sequence GACACTGGTGAGTTTACGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912654709_912654712 -9 Left 912654709 1:111476045-111476067 CCACATGTAAACCCGACACTGGT 0: 1
1: 0
2: 0
3: 8
4: 76
Right 912654712 1:111476059-111476081 GACACTGGTGAGTTTACGACAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912654712 Original CRISPR GACACTGGTGAGTTTACGAC AGG Exonic
912558028 1:110530289-110530311 GGCACTGAAGAGTTTACGATGGG + Intergenic
912654712 1:111476059-111476081 GACACTGGTGAGTTTACGACAGG + Exonic
1063882592 10:10546443-10546465 GTCATTGGTGAGTTTAAGCCTGG + Intergenic
1065705427 10:28467840-28467862 GACACTGGTGACTTTGTGCCAGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1072411571 10:95207312-95207334 GACACGGCAGAGTTTACAACTGG - Exonic
1072471323 10:95716717-95716739 GAGACTGGGAAGTTTAAGACTGG - Intronic
1073590354 10:104751520-104751542 GACACTGGAGAGTTTAGGATAGG + Intronic
1073707008 10:105995714-105995736 AACATTGGGGAGTTTACAACTGG + Intergenic
1075940290 10:126385828-126385850 GCCACTGGGGAGTTTTAGACAGG + Intronic
1086529630 11:87769466-87769488 GAGACTGGGCAGTTTACGAAAGG - Intergenic
1088357171 11:108956408-108956430 GACACTGGTGGCTTTACCAAAGG - Intergenic
1089461677 11:118657712-118657734 TACAGTGTTGAGTTTCCGACAGG + Exonic
1104844967 12:131842013-131842035 GACACTGGTGGAGTTACGACAGG + Intronic
1121256035 14:92531086-92531108 GACACTGGTGAATTTACTTTGGG - Intronic
1122313098 14:100809704-100809726 GTCACAGGTGGGTTTTCGACGGG - Intergenic
1127657526 15:61070474-61070496 CACAGTGGTGAGTTTAGGCCAGG - Intronic
1128774022 15:70305315-70305337 GACACTGGTTATTTTACGAAAGG - Intergenic
1133233921 16:4379011-4379033 GTCACTGGTGAGGTGACCACTGG - Intronic
1133487268 16:6232460-6232482 GATCCTGGTGATTTTACAACTGG + Intronic
1135718721 16:24795748-24795770 GACACTGATGAATTTGAGACTGG + Intronic
1143111642 17:4556146-4556168 GTCACTGGTGAGTTTAATGCAGG + Intergenic
1144090180 17:11849371-11849393 GCCACTGGTGTGTTTTCGGCAGG - Intronic
1150846991 17:68669180-68669202 AACACTGGTGAGATTCTGACAGG + Intergenic
1165574765 19:36805634-36805656 GCCACTGGTCAGTATACTACAGG - Intergenic
931840763 2:66145679-66145701 CACACTGGTGAGTTTGGGATGGG + Intergenic
945910150 2:215639654-215639676 GAAAATGGTGAGTTTACGTATGG + Intergenic
946337050 2:219044836-219044858 GACACTGGGTAGTTTAGGGCTGG + Intergenic
1174378261 20:50140358-50140380 GCCATTGGTGAGTTTCCCACAGG - Intronic
950348426 3:12321768-12321790 CACAGTGCTGAGTTTATGACTGG + Intronic
957245647 3:77712553-77712575 GGCACTGGTGAGTGGAAGACCGG - Intergenic
958735738 3:98007459-98007481 GACACTGGAAAGTTTAGAACAGG + Intronic
960434762 3:117612321-117612343 GACACTGGAGAATTTAAGAGGGG + Intergenic
966523471 3:180897543-180897565 GAAACTGGTTATTTTACCACTGG + Intronic
967426209 3:189330207-189330229 GAAACTGATGAGTTTATGCCAGG - Intergenic
974220816 4:58968705-58968727 GACACTGGTGAATATAAGAAGGG + Intergenic
998397816 5:141830622-141830644 CACACTGGTCAGTGTAAGACTGG - Intergenic
1004806072 6:19205209-19205231 GACACTGGTGAGTGCAGGTCTGG + Intergenic
1005917393 6:30365311-30365333 GACACTAGAGAGTTTGGGACAGG - Intergenic
1008357751 6:50574845-50574867 GAAACTGGTGGGTTCAAGACAGG + Intergenic
1050213982 9:3300868-3300890 GACACTGGTAAGTGTAAGAAGGG - Intronic
1059550961 9:115228388-115228410 GACACTGGTGAGAAGACCACAGG - Intronic
1196774812 X:119328494-119328516 GACACTGGTGAGTGAATGAGGGG - Intergenic
1197979079 X:132196903-132196925 GACACTGGGGAGCTTTTGACTGG + Intergenic