ID: 912655355

View in Genome Browser
Species Human (GRCh38)
Location 1:111481782-111481804
Sequence AGGTGGCCACAGCACCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912655355 Original CRISPR AGGTGGCCACAGCACCACCA GGG Intergenic
900114810 1:1023966-1023988 CGGTGGCCACAGCCCCTCCCGGG - Intronic
900189201 1:1346181-1346203 AGCTCCCCACAGCACCACCCAGG + Intronic
900362063 1:2293902-2293924 CGGTGGTCACCGCGCCACCATGG + Intronic
900790650 1:4677841-4677863 AGTTGGCTCCAGCACCACAATGG - Intronic
901257926 1:7848044-7848066 AGGTGGGCACAGGAGCCCCACGG - Intronic
901878246 1:12179319-12179341 AGGTCGTCACAGCAACGCCAGGG - Intronic
903831578 1:26178391-26178413 AGGTTGACACAGCCCCACCCTGG + Intronic
904237933 1:29125860-29125882 AGGTGGCAAGGGCACGACCAGGG - Intergenic
905001166 1:34671245-34671267 GGGTGGCCACAGCTGCACCTAGG - Intergenic
905223447 1:36464499-36464521 ACGTGGGCACACAACCACCACGG - Intergenic
905626848 1:39495085-39495107 TGGTGGCCCCAGAGCCACCATGG + Intronic
907460641 1:54603564-54603586 ATGAGGACACAGCAGCACCAGGG + Intronic
908980067 1:69945266-69945288 AGGTGTCAACAGCACCACAATGG - Intronic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
915615140 1:157031777-157031799 AGGAGTCCACACCACCACTATGG - Intronic
917068807 1:171126752-171126774 AAGTAGCTACAGCACCAGCATGG + Intergenic
917808900 1:178638539-178638561 GGGTGCCCACAGCACCCCCTCGG + Intergenic
918736615 1:188071924-188071946 AGGAGTCCACAGCAGCAGCAGGG + Intergenic
919083361 1:192891940-192891962 GGGTGGCCACAGCCCCACCCAGG + Intergenic
920648242 1:207818641-207818663 AAGACGCCACAGCCCCACCACGG + Intergenic
923783221 1:237043233-237043255 AAGCGGTCACAGCACCACCACGG - Intronic
924159200 1:241212715-241212737 AGGTGCCCACCTCACCAGCAGGG + Intronic
924273462 1:242359334-242359356 AAGTTGCCACAGCACCACACAGG - Intronic
924466317 1:244301943-244301965 AAGTGGCCACACCTCCTCCAGGG - Intergenic
1062923790 10:1299336-1299358 ACGTGGCCACAGCCCCAGCCTGG + Intronic
1063126987 10:3144077-3144099 AGGAGGACACACCCCCACCAGGG + Intronic
1063402884 10:5764600-5764622 AGATGGCAACAGCACCATCTTGG - Intergenic
1063976597 10:11422689-11422711 AGTTGGCCACATAACCACCTAGG - Intergenic
1066711255 10:38237320-38237342 AAGTTGCCACAGCACCACACAGG + Intergenic
1067458202 10:46438768-46438790 AGGAGGACACAGCAAAACCAGGG + Intergenic
1067628994 10:47945866-47945888 AGGAGGACACAGCAAAACCAGGG - Intergenic
1068130495 10:52889822-52889844 GGGTGGCTGCAGCAGCACCAGGG - Intergenic
1068166276 10:53336538-53336560 AGGTGGCCACTATACCACCATGG + Intergenic
1068397903 10:56487823-56487845 TGTTGGCCACAGCACTACGATGG + Intergenic
1075075772 10:119349328-119349350 AGCTGGACACAGCATCACTACGG - Intronic
1076080857 10:127579127-127579149 AGGTGACCCCAGCACCACTGTGG + Intergenic
1076851268 10:133094498-133094520 CGGCGGCCACAGCAGCCCCAGGG + Intronic
1077240504 11:1508118-1508140 AGGTGGCCATGGCAGCACCCGGG - Intergenic
1077415896 11:2424129-2424151 AGGTGGGCACAGGAGAACCAAGG - Intergenic
1077804742 11:5579388-5579410 TGGTCTCCACAGCACCATCAGGG - Intronic
1080701484 11:34647992-34648014 AGATGGCCACAGCACCTCCCAGG - Intronic
1083351858 11:62035316-62035338 AGTTGTGCACATCACCACCAAGG + Intergenic
1083372909 11:62195785-62195807 ATGTGGCCACAGGACCAGGACGG - Intergenic
1083384144 11:62295329-62295351 ATGTGGCCACAGGACCAGCATGG + Intergenic
1083785550 11:64943960-64943982 AGCTGGCCACAGCACAACTGGGG + Intronic
1084321407 11:68375447-68375469 TGGTGGGCACAGCACGAGCAGGG - Intronic
1085028854 11:73257711-73257733 AGGAGGCCACAGGGACACCAAGG + Intergenic
1090733054 11:129588501-129588523 ATGAGGGCACAGCACCACCGAGG - Intergenic
1092161318 12:6316943-6316965 AGGTCGCCACCCCACCCCCAGGG + Intronic
1092764282 12:11838750-11838772 GGGTGCCCACAGCACCCACAGGG - Intronic
1093652056 12:21657436-21657458 TGGCGGCCACATCACCCCCACGG - Intronic
1098392636 12:69985779-69985801 TGGTGGCCACAGTCCCACCCTGG - Intergenic
1099732873 12:86526851-86526873 AGGAGACCCCTGCACCACCATGG - Intronic
1099993715 12:89753729-89753751 AGTGGGCTACAGCACCACAAGGG + Intergenic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1101553969 12:105789536-105789558 AGGAATCCACAGGACCACCAAGG + Intergenic
1101897777 12:108768987-108769009 AGGTGGCCTCCGCAGCCCCAGGG - Intergenic
1102535287 12:113576413-113576435 AGGTGGGCACAGACCCACAAGGG - Intergenic
1103780461 12:123395344-123395366 AGGTGGCCACTGAACCCCCATGG - Intronic
1103936526 12:124480338-124480360 ACCTGGCCACAGCCCCACCCTGG + Intronic
1105284539 13:18993596-18993618 AGGTGGCCAGATGACCAGCAAGG + Intergenic
1105630872 13:22166112-22166134 AGCTAGCCACAGCAGCATCATGG + Intergenic
1105975996 13:25473101-25473123 TTGTGGCCTCAGCACCCCCAGGG + Intronic
1108455318 13:50607727-50607749 CAGTGGCCCCAGCACCACCATGG - Intronic
1108593776 13:51933593-51933615 GAGTGGCCACAGCACCCCGAAGG - Exonic
1111931127 13:94514295-94514317 AGGTGGCCAAACCACCAAAACGG + Intergenic
1112434199 13:99379567-99379589 AGGTGTTCACTGCAACACCAAGG + Intronic
1114407943 14:22473878-22473900 CGGTGGCAACAACAACACCATGG - Intergenic
1115193225 14:30769341-30769363 ATCTGTCCACCGCACCACCAGGG - Intergenic
1116257142 14:42571041-42571063 TGGTGGCCGCAGCCCCACCTGGG - Intergenic
1117053512 14:51886664-51886686 TGGAGGCCACAGCTCCACTAAGG - Intronic
1119077068 14:71651431-71651453 AGTTGGCAACAGCAAAACCATGG - Intronic
1119764705 14:77181254-77181276 AATTGGCCACAGCCCCACCAGGG - Intronic
1121553465 14:94819502-94819524 AGGTGGCCCCAGCGGCACCTGGG + Intergenic
1122583567 14:102787782-102787804 AAGTGACCACAGCAACAGCATGG - Intronic
1122694908 14:103547759-103547781 AGATGGCCACAGCAGGCCCAGGG - Intergenic
1122967605 14:105138601-105138623 AGGTGGCCACTGCAGCCCCGGGG - Intergenic
1123144608 14:106116566-106116588 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123156814 14:106234993-106235015 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123207585 14:106728094-106728116 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123211686 14:106767106-106767128 AAGTGGGCACAGGACCACCTGGG - Intergenic
1123212596 14:106775088-106775110 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1202903082 14_GL000194v1_random:54309-54331 AGGTGGGGACAGCACCCTCAGGG + Intergenic
1123666138 15:22610624-22610646 TGGTGACCACAGCACCCCCCAGG - Intergenic
1124319961 15:28705030-28705052 TGGTGACCACAGCACCCCCCAGG - Intronic
1124482549 15:30090387-30090409 TGGTGACCACAGCACCCCCCAGG + Intronic
1124489005 15:30142489-30142511 TGGTGACCACAGCACCCCCCAGG + Intronic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1124754525 15:32395834-32395856 TGGTGACCACAGCACCCCCCAGG - Intronic
1125515246 15:40315495-40315517 AGGTGGACACATCAGCAGCATGG - Intergenic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1128658327 15:69478909-69478931 AGGTGTCCACAGCAGCACAGGGG - Intergenic
1128734537 15:70045601-70045623 AGGTGGCCCCAACCCCAGCATGG - Intergenic
1128965141 15:72051378-72051400 AGGTGGCCGCAGCTGCACCTAGG - Intronic
1129619218 15:77128529-77128551 GGGTGGCACCATCACCACCATGG - Intronic
1129678211 15:77643671-77643693 AGGTGGCCACCCCAGCACCATGG + Intronic
1130916364 15:88308118-88308140 ATGTGGCCCCAGCTTCACCAGGG - Intergenic
1131174213 15:90200132-90200154 GGGTGGGCACAGCACCCACATGG - Intronic
1132110223 15:99097392-99097414 AGGGACCCATAGCACCACCATGG + Intergenic
1132204777 15:99978705-99978727 AGGTGCCCCCAACACCAGCAGGG - Intronic
1132233331 15:100200752-100200774 TGGTGGCCACAGCCCATCCAGGG - Intronic
1132295829 15:100733573-100733595 AGGTGGCCATAGAACTAACAAGG + Intergenic
1132712661 16:1276446-1276468 GGGGGGCCACAACACCCCCAGGG - Intergenic
1132831410 16:1930047-1930069 CAGGGGCCACAGCCCCACCAGGG + Intergenic
1132854783 16:2039884-2039906 CGGTGGCCACAGCGGCACCTCGG + Exonic
1134267288 16:12703111-12703133 AGGCGGCATGAGCACCACCATGG - Intronic
1135824142 16:25711481-25711503 ACGGGGCCACCACACCACCAAGG - Intronic
1138590887 16:57999167-57999189 AGAGGGCCACAGAACCACCCAGG + Intronic
1139578461 16:67857367-67857389 AGGTGCCCACAGCACCCTAAGGG - Intronic
1141794444 16:86260954-86260976 AGGTGACTCCAACACCACCACGG + Intergenic
1142590736 17:1004685-1004707 GGGTGCCTACAGCACCAACAAGG + Exonic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1144913278 17:18700862-18700884 AGGTGGCCACAGACTCACCGTGG + Intronic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1151343072 17:73484324-73484346 GGGTGGCCAGAGCAGCCCCATGG + Intronic
1152225209 17:79089797-79089819 AGGTGGCGGGAGCAGCACCAAGG - Intronic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1157504669 18:48218024-48218046 AGACTGCCACACCACCACCATGG + Intronic
1160750313 19:731034-731056 AGGTGCCCAGAGCCCCACCGGGG + Intronic
1160765247 19:804706-804728 AGGTGGTCCCATCACCGCCAGGG + Intronic
1160885163 19:1342811-1342833 AGGTGCCCACATCACCACGCAGG - Intergenic
1161932533 19:7350244-7350266 AGGTGGCCCCAGAACCAGGAGGG + Intronic
1162725851 19:12689411-12689433 ACGTGCCCACAGACCCACCAAGG - Exonic
1163102148 19:15104576-15104598 AGGTGGCCTCAGAAGAACCAGGG + Intergenic
1165408850 19:35646121-35646143 ACGTGGCTACAGCAGCAACAGGG + Intergenic
1165855275 19:38876334-38876356 TAGTGGCCACAGCCCCACAAGGG + Exonic
1166702724 19:44891477-44891499 AGGTGGCGGCAGCCCCACGAGGG - Exonic
1167449037 19:49556409-49556431 GGGTGACCACAGCCCCACTACGG + Exonic
925286691 2:2720983-2721005 AGGTGCCGGCAGCACGACCAGGG - Intergenic
925368311 2:3325890-3325912 AGCAGGGCACAGCACCTCCAGGG - Intronic
926599360 2:14825222-14825244 AGGTGGCCAGAGCCCCATCGTGG - Intergenic
927113410 2:19880041-19880063 AGATGGCCACAGTCCCACTAGGG - Intergenic
927654498 2:24933898-24933920 AAGTGGCCTCAGCATCACCTGGG - Intergenic
929267684 2:39937617-39937639 AGCTTCCCATAGCACCACCATGG + Intergenic
929578608 2:43068145-43068167 GGGTGGCCACGGCAGCAGCACGG + Intergenic
929603516 2:43219703-43219725 AGGAAGCCACAGCACCTCCAGGG - Intergenic
929785814 2:44990311-44990333 AGGTGGGCACAGAACCAAGAAGG + Intergenic
931372618 2:61677860-61677882 AGGGGGCCACAGGACCAGCTGGG - Intergenic
931679076 2:64728208-64728230 AGGTGCCCACAGCACTGCAAGGG + Intronic
937205067 2:120231082-120231104 AGGTGGCCATAGGAGCCCCATGG - Intergenic
937228769 2:120384761-120384783 AGGGGGAGACAACACCACCAAGG - Intergenic
937907679 2:127060333-127060355 TGGTGGCCCGGGCACCACCAGGG + Intronic
938031664 2:127999756-127999778 AGGTGGTCACAGCAGTAGCATGG + Exonic
938487354 2:131724196-131724218 AGGTGGCGGCAGCTCCACGAGGG + Intronic
940012922 2:149073591-149073613 AGGGGGCCTCAGCAGCACAACGG - Intronic
944925540 2:204460400-204460422 AGATGGCCACAGCAACTCCAAGG + Intergenic
945250996 2:207766874-207766896 AGGGGGCAACAGCACCATGAAGG + Exonic
947435443 2:230068458-230068480 AGATGGCCGCTGCACCCCCAGGG - Intronic
948293634 2:236845465-236845487 GGGTGGCCACAGCTGCACCTGGG + Intergenic
948423044 2:237872243-237872265 AGGTGCCCCCGGCAGCACCAGGG - Intronic
948454444 2:238098268-238098290 CGTGGGCCGCAGCACCACCAGGG + Exonic
948457838 2:238115194-238115216 AGGAGGCCACAGCGCCACCAGGG - Intronic
948466360 2:238153566-238153588 AGGTGGCCAGGGCACCAGGACGG + Intergenic
948982483 2:241501431-241501453 AGCCGGGCACAGCACCAGCAGGG + Intronic
1168852526 20:986317-986339 TGGAGGCCACAGCAGCATCAGGG + Intronic
1170148531 20:13204362-13204384 AGGTGGACACAACTCCAACAAGG - Intergenic
1171045717 20:21808275-21808297 TGGAGGCCACATCACCACCCAGG - Intergenic
1172043114 20:32060064-32060086 TGGTGGCCAGTTCACCACCAGGG - Intronic
1172225887 20:33304984-33305006 AGGTCCCCACAGAAGCACCATGG + Intronic
1173461915 20:43249689-43249711 ATGTGGCCCCAGGACCTCCACGG + Intergenic
1173523398 20:43715280-43715302 AGATGGCCACAGCACTCACAGGG - Exonic
1173646015 20:44633632-44633654 AGGAGGCCACAGCACCAGGGAGG + Intronic
1174076511 20:47941357-47941379 AGGAGGACACAGAAGCACCACGG - Intergenic
1174321099 20:49742203-49742225 AGGAGGCCGCAGCTCCAGCAAGG + Intergenic
1174357971 20:50010628-50010650 GGGTGGCTCCAGCCCCACCATGG - Intergenic
1175575330 20:60056593-60056615 AGCTGCCCACAGAGCCACCATGG - Intronic
1175879189 20:62246935-62246957 AGGTTGCCAGAGCACCAGGAAGG - Intronic
1176036760 20:63043381-63043403 CGGTGGCCACGGCACCTGCAAGG + Intergenic
1176109089 20:63403041-63403063 AGGAGGGCCCAGCACCTCCAGGG + Intergenic
1176143904 20:63557065-63557087 AGGAGGCAGCAGCACCACCGGGG + Intergenic
1176622446 21:9069076-9069098 AGGTGGGGACAGCACCCTCAGGG + Intergenic
1179318833 21:40270723-40270745 AGGTGGCCAAAGCTTCACCATGG + Intronic
1179569737 21:42271395-42271417 CAGTGGCCACAGCAGCACCCTGG + Intronic
1179802287 21:43816662-43816684 AGCTGGCCACAGCCCCAGCAGGG + Intergenic
1180917887 22:19501481-19501503 AGGAGGCCACAAGACCTCCAAGG - Intronic
1181614534 22:24044058-24044080 AGGTGGCAACATCACCCTCATGG + Intronic
1181729602 22:24835092-24835114 AGGGGGAAACATCACCACCAAGG - Intronic
1181929046 22:26384614-26384636 AGGTGGCAGCATCACCTCCACGG + Intergenic
1182012452 22:27012061-27012083 AGGTGGCCTCAGAACCATAAAGG + Intergenic
1182611409 22:31550744-31550766 AAGTGGCCACAGTATCACTAAGG - Intronic
1183589367 22:38770783-38770805 AGGAGGCAACAGCACCCACATGG - Intronic
1184368098 22:44065229-44065251 AGCTGCCCTCAGCACCACTATGG - Intronic
1185019662 22:48366827-48366849 AGGTGGCCACTGCACCGTCCAGG + Intergenic
1185228828 22:49668534-49668556 ATGAGGCCACAGCAGCAGCAAGG + Intergenic
950268339 3:11592433-11592455 AGGTCCCCACAGCCTCACCAGGG - Intronic
950544998 3:13633123-13633145 AGGTGTCCTGAGCACCCCCAAGG - Intronic
951234858 3:20222428-20222450 AGGTGGCCACACAATCACAATGG - Intergenic
952328055 3:32338540-32338562 AGATGGGTACAGCACCACCTAGG - Intronic
953331833 3:42060314-42060336 AGATGGCTACAGCACCACGGTGG + Intronic
953543019 3:43839527-43839549 ATGTGGTGACAGCAGCACCATGG - Intergenic
954605232 3:51904373-51904395 AGGTGGCCACTGCACAAGCATGG + Intergenic
956625486 3:71262599-71262621 AGGTGGGCACAGAACCAACGTGG + Intronic
960785092 3:121363393-121363415 ATGTGGAAACATCACCACCAAGG - Intronic
961784833 3:129341474-129341496 AGGTGGCCACAGCAGCCCACAGG + Intergenic
962129567 3:132659130-132659152 AGGAGGTCACAGCACCACTTTGG - Intronic
963852844 3:150225159-150225181 AGTTGACCCAAGCACCACCATGG + Intergenic
964256140 3:154776653-154776675 AGGTGGTCACAGCAGGAACAAGG + Intergenic
966919227 3:184601620-184601642 AGGTGGCCAAGGCGCCCCCACGG - Intronic
967303328 3:188038026-188038048 CACTGGCCACAGCACCACCAGGG + Intergenic
968199228 3:196738262-196738284 AGGTGCCCTCAACACAACCATGG + Intergenic
968512538 4:1001950-1001972 GGGCCGCCTCAGCACCACCAGGG - Intronic
968580057 4:1385589-1385611 AGGTGGCCCCAGCCCCACCTTGG - Intronic
968870737 4:3240867-3240889 AGGTGGCCACAGCAGGACTGAGG + Exonic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG + Intronic
975321206 4:73011654-73011676 GGGTGGCCACAGCTGCACCCAGG - Intergenic
975651572 4:76598645-76598667 AGGTGGATACAGCTGCACCAGGG - Intronic
975816956 4:78227790-78227812 AGGTGGCTACTGCAGCAGCAAGG + Intronic
977751689 4:100617134-100617156 AGGTGACAACAGCGCCTCCATGG + Intronic
979388660 4:120100545-120100567 GGGTGGCAACATCACCCCCATGG + Intergenic
980980861 4:139653664-139653686 AGCTGGCCACAGCAGAGCCAAGG - Intergenic
982272801 4:153608494-153608516 GGTTGGCCGCAGCACTACCAAGG + Intronic
985567042 5:624277-624299 AGGCGGCCTCAGCACCACGCTGG + Intronic
985621676 5:959386-959408 AAGTGGCCACTCCCCCACCATGG + Intergenic
986038263 5:3961433-3961455 GTGTGACCATAGCACCACCATGG - Intergenic
986215171 5:5712955-5712977 GGGTGGCCACAGCTGCACCCAGG + Intergenic
989099636 5:37811914-37811936 AGCTGGCCTCAGCACCACCCTGG + Intergenic
990639067 5:57761911-57761933 GGGTGGCCGCAGCAGCACCTGGG - Intergenic
994245513 5:97471623-97471645 AGGTGGCTACAGCTGCACCTGGG + Intergenic
1002524522 5:179807552-179807574 AGGTGGCCCCTACACCACCGGGG - Intronic
1005709102 6:28486462-28486484 AGGTGGTTACAGGAACACCAAGG - Intergenic
1006131871 6:31874574-31874596 AGGTCCCCTCACCACCACCATGG + Intronic
1007416440 6:41694037-41694059 CGGTGCCCACACCCCCACCAGGG - Intronic
1007596383 6:43053601-43053623 AGGTGGCCAGAGCCCCACCGCGG - Intronic
1007665648 6:43511411-43511433 AGCTGGCCCCAGTACCACCAAGG + Intronic
1007833074 6:44653706-44653728 AGGTGGCCACAGCATGACATAGG - Intergenic
1010392122 6:75349701-75349723 ACGCGGCCACAGCACCTGCAGGG - Intronic
1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG + Intronic
1016907790 6:149168938-149168960 AGGAGGGCACAGCACCATGAGGG + Intergenic
1017028416 6:150200602-150200624 AGGAGGCCACAGCTGCACCTAGG - Intronic
1017780791 6:157713760-157713782 CGGTGTCCACAACACCATCATGG + Intronic
1018952810 6:168390301-168390323 ATGTGGCCACACGCCCACCAGGG - Intergenic
1019293452 7:261564-261586 AAGGGGCCACAGCACCTCCCTGG - Intergenic
1019652984 7:2170687-2170709 AGGTGGCCACTGCACGAGAAAGG + Intronic
1019938658 7:4272343-4272365 TGGCGGCCTCAGCACCCCCATGG + Intergenic
1019939401 7:4277256-4277278 AGGTGTCCACAGGAAAACCAGGG + Intergenic
1022529994 7:31061089-31061111 AGGTGGCAGCAGCACTACCCCGG - Intronic
1022834879 7:34103855-34103877 AGGTGGCCCTTGCACCTCCAGGG - Intronic
1024346753 7:48321695-48321717 AGGTGGCCTCAGCACCAAGCTGG + Intronic
1026846575 7:73702119-73702141 AGCTGGCCCCAGCAACACTAAGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029714236 7:102317414-102317436 GGCTGGCCACTGCACCCCCATGG - Intronic
1030455422 7:109766849-109766871 AGGAAGCCACAGCAGCCCCATGG + Intergenic
1034215377 7:149401548-149401570 AGGTGGCGACAGCAGCCACAGGG + Intergenic
1040546510 8:48402140-48402162 AGCTGGCAACAGCCCCACCAAGG + Intergenic
1042468993 8:69161816-69161838 GAGTGGCCTCAACACCACCATGG - Intergenic
1044622885 8:94207843-94207865 AGGTGGTAACTCCACCACCAAGG + Intronic
1047673395 8:127173132-127173154 GGGTTGCCACAATACCACCAGGG - Intergenic
1048162007 8:132029934-132029956 GGGAGGCCACAGCTCCAGCAGGG + Intronic
1048730446 8:137434390-137434412 AGATGACCACAGCAGCAGCATGG - Intergenic
1049556815 8:143286651-143286673 AGGTGGACAGAGCACCACGGGGG - Intergenic
1049782597 8:144435702-144435724 AGGGAGCCCCAGCACCCCCAGGG - Exonic
1049823889 8:144654764-144654786 GGGTGGCTGCAGCACCACCCAGG - Intergenic
1056543738 9:87595855-87595877 AGGTTGCCACGGCACCAACAGGG - Intronic
1056972550 9:91219174-91219196 TGGTGGCCACAGAAGCATCATGG + Intronic
1057856755 9:98606860-98606882 AAGCGTCCACAGCAGCACCATGG + Intronic
1060340009 9:122767301-122767323 AGGTGGTGCCAGCAGCACCATGG - Intergenic
1061962382 9:133994571-133994593 CCGTGGTGACAGCACCACCAGGG - Intergenic
1062068174 9:134540081-134540103 AGCTGGCCACGGCAGGACCATGG - Intergenic
1062171767 9:135138671-135138693 AGGGGCCCACAGCAACACCATGG + Intergenic
1203745642 Un_GL000218v1:39505-39527 AGGTGGGGACAGCACCCTCAAGG + Intergenic
1203564468 Un_KI270744v1:79978-80000 AGGTGGGGACAGCACCCTCAGGG - Intergenic
1185733382 X:2478847-2478869 ATGTGGCCAAGGGACCACCACGG + Intronic
1188492983 X:30755746-30755768 AGGAGGCCACTCGACCACCACGG + Intergenic
1190713912 X:53088335-53088357 AGGTGGCAGCAGCGCCTCCATGG - Exonic
1192314374 X:70040468-70040490 AGGTGGCCATAGGACCAGCCTGG - Intergenic
1196518124 X:116638500-116638522 AGTCAGCCACAGCACCACGAGGG - Intergenic
1198867669 X:141141933-141141955 AGGTTGCCAGAGTACCAGCATGG + Intergenic
1199196452 X:145037032-145037054 AAGTGGCAAAAGCACCCCCATGG + Intergenic
1200121391 X:153792640-153792662 AGATGGCAACATCACCACCAGGG + Intronic
1201158968 Y:11154517-11154539 AGGTGGGGACAGCACCCTCAGGG + Intergenic