ID: 912656435

View in Genome Browser
Species Human (GRCh38)
Location 1:111490109-111490131
Sequence CTGTCTGACCTTCAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912656435_912656442 17 Left 912656435 1:111490109-111490131 CCACACAACTGAAGGTCAGACAG 0: 1
1: 0
2: 3
3: 9
4: 152
Right 912656442 1:111490149-111490171 TGTTCCAAGTCTCATCTTTGGGG No data
912656435_912656441 16 Left 912656435 1:111490109-111490131 CCACACAACTGAAGGTCAGACAG 0: 1
1: 0
2: 3
3: 9
4: 152
Right 912656441 1:111490148-111490170 GTGTTCCAAGTCTCATCTTTGGG No data
912656435_912656438 -10 Left 912656435 1:111490109-111490131 CCACACAACTGAAGGTCAGACAG 0: 1
1: 0
2: 3
3: 9
4: 152
Right 912656438 1:111490122-111490144 GGTCAGACAGAGCTGGGAAAAGG 0: 1
1: 0
2: 0
3: 48
4: 361
912656435_912656440 15 Left 912656435 1:111490109-111490131 CCACACAACTGAAGGTCAGACAG 0: 1
1: 0
2: 3
3: 9
4: 152
Right 912656440 1:111490147-111490169 AGTGTTCCAAGTCTCATCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912656435 Original CRISPR CTGTCTGACCTTCAGTTGTG TGG (reversed) Intronic
903168259 1:21536380-21536402 CTGGCTGAGCTGCAGTTCTGAGG + Intronic
904038692 1:27572060-27572082 CTGTCAGGCCTTGAGTTGGGGGG - Intronic
905166463 1:36086002-36086024 CTGGCTGACCTTCTGTTGCAAGG - Exonic
906141283 1:43535237-43535259 GTGTTTGACCTTCAGGTGGGTGG + Intronic
907738419 1:57139277-57139299 CTTTCTGCCCTTCTGTTTTGAGG + Intronic
908473830 1:64470197-64470219 CTTTCTTTCTTTCAGTTGTGTGG + Intergenic
911985830 1:104620775-104620797 CTGTTTGACCTTGAGTGGGGTGG - Intergenic
912656435 1:111490109-111490131 CTGTCTGACCTTCAGTTGTGTGG - Intronic
912805902 1:112756961-112756983 CTGTCTGATCTCCAGTTTTCAGG + Intergenic
913213617 1:116601875-116601897 CTCTCTCCCCTTCAGGTGTGAGG - Intronic
915070708 1:153263432-153263454 CTGTCAGTCCTTTAGTTCTGAGG - Intergenic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
920513456 1:206567328-206567350 CTGTCTGCCTTTCAGCTTTGGGG + Intronic
921076187 1:211701987-211702009 CTCTCTGAACTTCAGTTGTCTGG + Intergenic
921680685 1:218027315-218027337 CTGTCTGCTCTTCGTTTGTGTGG - Intergenic
922280873 1:224122779-224122801 CTGTCTAACCTTTAGCAGTGTGG + Intronic
922632138 1:227126215-227126237 CTCCCTGACCTCCAGGTGTGTGG + Intronic
924384863 1:243491038-243491060 CTGTCAGACCTCAGGTTGTGGGG + Intronic
1066256099 10:33680139-33680161 CAGTCTGAGCATCAGCTGTGGGG + Intergenic
1069626936 10:69874023-69874045 CTTTCTGAGCATCAGTTCTGTGG - Intronic
1070446415 10:76508853-76508875 TTCTATCACCTTCAGTTGTGTGG - Intronic
1071090115 10:81908733-81908755 CTGTCTGACCCCCACTTCTGTGG - Intronic
1071162882 10:82771512-82771534 CTGGCTGATCTTCAGAAGTGTGG + Intronic
1073546552 10:104354080-104354102 CTGTTTCTCCTTCATTTGTGTGG + Intronic
1073844174 10:107533440-107533462 GTGGATGAGCTTCAGTTGTGTGG + Intergenic
1076009539 10:126976575-126976597 CTGTCTGATCTTTGGTTCTGAGG + Intronic
1079719677 11:23793921-23793943 CTGTCTTGTCTTCAGTGGTGAGG - Intergenic
1080605076 11:33858894-33858916 CTTTCTGTCCTTCCCTTGTGTGG + Exonic
1091227785 11:133967990-133968012 CTGGCTGTACTGCAGTTGTGAGG - Intergenic
1091298442 11:134489605-134489627 CTGTGTGACCTGAAGTTGTCAGG - Intergenic
1091298457 11:134489671-134489693 CTGTGTGACCTGAAGTTGTCAGG - Intergenic
1091298481 11:134489770-134489792 CTGTGTGACCTGAGGTTGTGAGG - Intergenic
1092806345 12:12226894-12226916 CTGTCTGACATTAGTTTGTGTGG - Intronic
1094163874 12:27422219-27422241 CTATCTGACTTTCATTTGCGAGG - Intronic
1094224151 12:28026753-28026775 CTGTGTGACCTCCAGGGGTGGGG - Intergenic
1098278500 12:68838183-68838205 CTGTCTTAACATCATTTGTGAGG + Intronic
1101254786 12:102966264-102966286 CTGTCTGGTCTTCAGGAGTGGGG - Intergenic
1101480253 12:105089884-105089906 CTGACAGATCTTCAGCTGTGGGG + Intergenic
1104516936 12:129436069-129436091 CTGTCTGAAGTGCAGCTGTGAGG + Intronic
1105216851 13:18292432-18292454 CTCTCTCCCCTTCAGGTGTGAGG - Intergenic
1105859294 13:24395090-24395112 TCGCCTGACCTTCAGTTCTGGGG + Intergenic
1106411628 13:29515010-29515032 CAGTCTGACGCTCAGTTATGTGG - Intronic
1107380041 13:39847125-39847147 CTGGCTGGCCATCAGGTGTGTGG - Intergenic
1110165871 13:72442438-72442460 TTTTCTGAGCATCAGTTGTGGGG - Intergenic
1111156473 13:84334161-84334183 ATATCTGAGCTTCAGTTGTTTGG + Intergenic
1120246380 14:82011511-82011533 CTGTCTGACTTTGAGTGGTGGGG + Intergenic
1120294259 14:82621205-82621227 ATGTCTGACCTACAGATGTATGG - Intergenic
1122143702 14:99676687-99676709 CTCTCTGACCTGCACCTGTGTGG + Exonic
1123409259 15:20044778-20044800 CTGTGTGTCCTTCGGGTGTGAGG - Intergenic
1123518590 15:21051486-21051508 CTGTGTGTCCTTCGGGTGTGAGG - Intergenic
1126111294 15:45176357-45176379 ATATCTGACCTTCAGTTGTGTGG + Intronic
1126111525 15:45177935-45177957 CTATCTGAACTTCAGTTGTGTGG + Intronic
1127486348 15:59421318-59421340 CTTTCTGACCTACAGTGATGGGG - Intronic
1127666790 15:61155679-61155701 CTGTCTCATCTTCAGCTGTGAGG + Intronic
1127969215 15:63945724-63945746 CTGCCTGACTTACAGTTGGGGGG - Intronic
1128691647 15:69728799-69728821 CTGTATGAACTTCTATTGTGTGG + Intergenic
1130931890 15:88435168-88435190 CTGTATGATATTCAGTTGTATGG - Intergenic
1135110914 16:19690288-19690310 CTGTGTGAAGTTCAGTTGAGAGG + Intronic
1135828135 16:25748452-25748474 CTCTCTGAGCTGCAGGTGTGGGG - Intronic
1136871548 16:33812255-33812277 CTGTGTGTCCTTCGGGTGTGAGG + Intergenic
1137621326 16:49878235-49878257 CTGCCTGACATTCAGTACTGTGG - Intergenic
1140830904 16:78749902-78749924 CTCTCTGACCTTCTATTTTGAGG - Intronic
1142435907 16:90057174-90057196 CTGTCTGGCGTTCACTTCTGGGG + Intronic
1203100624 16_KI270728v1_random:1303803-1303825 CTGTGTGTCCTTCGGGTGTGAGG - Intergenic
1143014045 17:3882441-3882463 ATGTATGACCTTCAGGTGGGCGG - Intronic
1144790119 17:17853197-17853219 CTTTCTAAGCTTCAGTTTTGGGG - Intronic
1145266653 17:21382961-21382983 CTGTGTGACCTCCGGCTGTGGGG - Intronic
1147658005 17:42101939-42101961 CTGTCTCACCTCCAGGTCTGGGG - Exonic
1150303713 17:64066738-64066760 CTATCTGACCTTCATGTCTGGGG - Exonic
1151527555 17:74681332-74681354 CCCTCTGACCTTCAGAGGTGGGG - Intronic
1151849349 17:76681191-76681213 CTTTCTGATCTTGGGTTGTGTGG + Intronic
1155123174 18:22843376-22843398 CTGTCAGACCTCCTGTTGTGAGG + Intronic
1156369454 18:36459539-36459561 CTGTCTGACCTGCAGTGTGGGGG + Intronic
1158120762 18:54045995-54046017 TTGACTGCCATTCAGTTGTGTGG - Intergenic
1158198844 18:54917877-54917899 CTGTCTTACATTTTGTTGTGAGG - Intronic
1159386937 18:67738812-67738834 CTGTGTGTTCTTCAGTTGTTGGG + Intergenic
1161907949 19:7171380-7171402 CTGTCTGTTCTACAGATGTGAGG + Intronic
1165444262 19:35848313-35848335 CGGTCTGACCCTCACATGTGAGG - Exonic
1166745475 19:45140017-45140039 CTGGCTGGTCCTCAGTTGTGTGG + Intronic
1168564206 19:57409505-57409527 CTTCCAGACCTTCAGTTGGGTGG + Intronic
926103769 2:10137527-10137549 CTGTCTGCACTTCACTAGTGGGG + Intergenic
926537058 2:14125927-14125949 CTCTCTGACCTCCAGCAGTGAGG - Intergenic
930090396 2:47527546-47527568 CTGCCTGACCTACTCTTGTGAGG + Intronic
934297473 2:91754253-91754275 CTCTCTCCCCTTCAGGTGTGAGG + Intergenic
934740312 2:96716383-96716405 GTGTATGAACTCCAGTTGTGTGG - Intronic
934951105 2:98576345-98576367 CTGTGAGCCATTCAGTTGTGAGG + Intronic
936786027 2:116094987-116095009 CTGTGTGGCCTACAGTTATGGGG + Intergenic
945160757 2:206887940-206887962 TTGGCTGACTTTCAGCTGTGTGG - Intergenic
945373360 2:209049239-209049261 CTGAATGACCTTTATTTGTGTGG + Intergenic
946161166 2:217836874-217836896 CTGTCTGCTCTTCAGCTGGGAGG - Intronic
1168881237 20:1207842-1207864 CTCTCTGTCCATCTGTTGTGTGG - Exonic
1170531249 20:17294512-17294534 CTGTCTAACCTTCATGTGTGAGG - Intronic
1171793455 20:29548526-29548548 CTGTCTGTCCCTCAGCTCTGGGG - Intergenic
1176046542 20:63095906-63095928 CTTTCTGACCTGCAGCCGTGAGG - Intergenic
1176208485 20:63904544-63904566 GTGTCTGACCTCCAGGTGGGCGG + Intronic
1177353646 21:19978727-19978749 CTGTCAGATCTCCATTTGTGAGG - Intergenic
1184535481 22:45083708-45083730 CTGTCTGTATTTCAGCTGTGTGG + Intergenic
949514661 3:4796216-4796238 CTGTTTGACCTTAAGTTACGTGG + Intronic
951520072 3:23603149-23603171 CTGTCTGGCCTTCAGCTCTCTGG + Intergenic
953350708 3:42213679-42213701 CTGTCTGAACCCCAGTTCTGTGG - Intronic
954316450 3:49804166-49804188 CTCTCTTCCCCTCAGTTGTGTGG + Exonic
960602058 3:119468736-119468758 CTCTCTGACCTTCAGTTTTCTGG + Intronic
961265293 3:125636763-125636785 CTGACTAACCTACAGTGGTGAGG + Intergenic
966773669 3:183525424-183525446 GTGTCTTCCCATCAGTTGTGTGG - Intronic
966888312 3:184388720-184388742 CTGTATCACCTGCAGATGTGGGG + Exonic
967932540 3:194700710-194700732 AAGTCTGGCCTTCAGTTATGAGG + Intergenic
970008376 4:11431369-11431391 GTGTCTGTCAGTCAGTTGTGTGG + Intergenic
980389623 4:132126124-132126146 GTGTCTGACTTTCAGTGGTCTGG - Intergenic
981443130 4:144806270-144806292 CTGTGTGGCCTTCAGTCCTGGGG - Intergenic
982762005 4:159295789-159295811 TTTTCTGACCTTCAGATGTTGGG + Intronic
983747644 4:171221487-171221509 CTGTCTGAATTTCCATTGTGTGG + Intergenic
986393303 5:7304455-7304477 CTTTCAGACTTTCAGTTCTGTGG - Intergenic
987380593 5:17282155-17282177 GTGCCTGACTTTCAGGTGTGTGG - Intergenic
989423068 5:41263376-41263398 TTGTCTGACCTTGAATTTTGAGG - Intergenic
991949731 5:71935837-71935859 CTGTCTCACCTTCTGTTGGTGGG + Intergenic
992325562 5:75656320-75656342 ATGGCTGAACTCCAGTTGTGTGG - Intronic
996804147 5:127435948-127435970 CTGTCTGAAATCCAGTGGTGTGG - Intronic
998696198 5:144642410-144642432 CTGTGTGACCATCTGTTGGGTGG + Intergenic
998822138 5:146066842-146066864 CTGTCTGAACCTTAGTTGAGGGG - Intronic
998909822 5:146947001-146947023 CTGTCTTTCCTTCAGTTGTGAGG - Intronic
1001912221 5:175530352-175530374 CTCTGTGACCTTCAGTTTTGTGG + Intergenic
1002801630 6:528691-528713 CTGTGTGACATTAAGTGGTGAGG - Intronic
1002807656 6:592561-592583 CTGTCTGACCTTCATGCGTCTGG - Exonic
1006174800 6:32115480-32115502 TTGTGTGAGGTTCAGTTGTGGGG - Exonic
1006626757 6:35403103-35403125 CTGCCTCACCATCAATTGTGGGG - Intronic
1008005994 6:46409958-46409980 CTGTCTGACCTCCAGCTGATTGG - Intronic
1010392788 6:75356206-75356228 CTGTTTGCCCTTCAGTTATAAGG + Intronic
1012505260 6:99939010-99939032 CTTTTTGACCTCCAGTTGTATGG + Intronic
1012740591 6:103011912-103011934 CTGTCTTACCTTGACTTCTGTGG + Intergenic
1014804132 6:125810200-125810222 CTGTGTGACCCACAGCTGTGTGG + Intronic
1016812662 6:148276107-148276129 CTCTCTGATTTCCAGTTGTGTGG + Intronic
1018268166 6:162048345-162048367 CTGTGTGACTGTCAGGTGTGAGG + Intronic
1020436239 7:8165100-8165122 ATATCTGACCTTCTGTTTTGGGG - Intronic
1021006354 7:15398815-15398837 CTCTCTGAGCTTCAGTTTTATGG - Intronic
1024486624 7:49927023-49927045 CTCTCTGACCTTCTGCTGTAAGG - Intronic
1028980505 7:96962681-96962703 CTGCCTGGCCTTCAGTTCTGTGG + Intergenic
1029592509 7:101516696-101516718 CTCTCTGAACCTCAGTTGTTTGG - Intronic
1033177414 7:139137520-139137542 CTCTCTAACCTTCAGTTATTTGG + Intronic
1035118455 7:156544965-156544987 CTAGCTGACCTTCAGGTGTGTGG - Intergenic
1038328744 8:26591318-26591340 CTGCCTGACCTTTGGATGTGAGG + Intronic
1039243014 8:35577298-35577320 ATGTGTTACATTCAGTTGTGAGG + Intronic
1040688101 8:49900972-49900994 ATGTCTGGCCTTTATTTGTGAGG + Intergenic
1043165928 8:76902363-76902385 CTGTATGAACCTCAGATGTGAGG - Intergenic
1047030000 8:120866343-120866365 CTCTATCACCTGCAGTTGTGTGG + Intergenic
1048897748 8:139008397-139008419 CTGTATGACTCTCAATTGTGTGG - Intergenic
1049361821 8:142215632-142215654 CAGTCTGCCCTCCAGGTGTGAGG - Intronic
1051849748 9:21492611-21492633 CTGTCTGAGCTCCAGCAGTGTGG - Intergenic
1053300892 9:36948714-36948736 CTATCTGACCTGCAGTGATGGGG - Intronic
1053792833 9:41699142-41699164 CTGTCTGTCCCTCAGCTCTGGGG + Intergenic
1054152341 9:61615683-61615705 CTGTCTGTCCCTCAGCTCTGGGG - Intergenic
1054181246 9:61911163-61911185 CTGTCTGTCCCTCAGCTCTGGGG + Intergenic
1054472116 9:65546826-65546848 CTGTCTGTCCCTCAGCTCTGGGG - Intergenic
1054656347 9:67669979-67670001 CTGTCTGTCCCTCAGCTCTGGGG - Intergenic
1057993637 9:99799256-99799278 CCTTCTGCCCTTCAGTTCTGAGG - Intergenic
1060228623 9:121811376-121811398 CTTTCTGACCTGCAGTCATGTGG + Intergenic
1061732776 9:132629327-132629349 CTGTGTGTCCTTCAGTGTTGGGG - Intronic
1062063705 9:134514588-134514610 CTGTCTGACCTGCATCTGAGGGG + Intergenic
1186315917 X:8370183-8370205 ATATTTGACATTCAGTTGTGGGG - Intergenic
1187774022 X:22734739-22734761 TTCTCTGACATTCAGTTGGGTGG + Intergenic
1189193904 X:39135689-39135711 CTGACTGACCTTCAATTGCCAGG - Intergenic
1190599044 X:52070769-52070791 CAGTCTGAACTTCACTTTTGAGG + Intergenic
1190609780 X:52183304-52183326 CAGTCTGAACTTCACTTTTGAGG - Intergenic
1190783314 X:53620053-53620075 CTGTATAACAATCAGTTGTGAGG - Intronic
1193667531 X:84340414-84340436 CAGTCTGAATTTCAGTTGTTAGG + Intronic
1200230669 X:154442359-154442381 CTGTCTGCCCCTCAGGTTTGTGG + Exonic