ID: 912656863

View in Genome Browser
Species Human (GRCh38)
Location 1:111494002-111494024
Sequence CTGAATATACAAGTGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 19, 3: 61, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912656863 Original CRISPR CTGAATATACAAGTGGACTA TGG Intronic
902469528 1:16638783-16638805 CTGAATACCCCAGTGGACCAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909690344 1:78399518-78399540 CTAAATATCCAAGGGGACTAGGG - Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914932649 1:151948820-151948842 CTGAATATGCACGTTTACTATGG + Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918572877 1:186019275-186019297 CCAAATATACATGTGGATTACGG + Intronic
918605494 1:186420186-186420208 TTGACCATACAAGTGGATTATGG + Exonic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919655923 1:200197185-200197207 CTGAATATTAAAGTAGTCTAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923115027 1:230927990-230928012 AGGGATAGACAAGTGGACTAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063317929 10:5024403-5024425 CTGAAAATGCAAGCGGACTCCGG + Intronic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1063556755 10:7087613-7087635 ATGAATATACTAGTGTGCTAGGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071823557 10:89302002-89302024 CTATATATACAAGTGGCCTCTGG - Exonic
1071952982 10:90726184-90726206 CAAAATATACATGTGGTCTATGG + Intergenic
1072005550 10:91243174-91243196 CTGAGTATACCAGGAGACTAAGG + Intronic
1073898765 10:108194388-108194410 GTGAATAGACAAGAGGACCAGGG - Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075427721 10:122354909-122354931 CTGAATATACAAGACCGCTAAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1091380467 12:54950-54972 CTGGATTTAAAAGTGGAATAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1095100882 12:38182733-38182755 ATGAATATACAAGTGCACGTGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1100612128 12:96199993-96200015 CTGAATATCCATGTGTAATATGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105994808 13:25660300-25660322 CAGAATATACCATTGGACTTTGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108305938 13:49132679-49132701 CTGAAGAAATAAGGGGACTAAGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110220030 13:73062158-73062180 CTGAATATACTGGTGAACTCAGG - Exonic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112376216 13:98843852-98843874 CTGCATATCCGAGTGGATTAAGG + Intronic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114000278 14:18232120-18232142 CAGAATCTACAAGTGGTCTTTGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1123190286 14:106562773-106562795 CTAAAAATACAGGTGGACTTAGG + Intergenic
1125308613 15:38352026-38352048 CTAAAAATAAAAGTGCACTAGGG + Exonic
1125878306 15:43168838-43168860 CTGACTAAACAAGTGCCCTAGGG - Intronic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135560402 16:23471972-23471994 CTGAAAATACCAGTGGGGTATGG + Intronic
1136518537 16:30782228-30782250 CTGATTATAGAATTGGCCTAGGG - Exonic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1146264705 17:31444649-31444671 CTAAAGATACATGTGGACTTGGG - Intronic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1153185627 18:2482929-2482951 CTGAATTTACAAGGAGACTGTGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925630002 2:5882225-5882247 CTGACAATACAAGTGGATTATGG + Intergenic
926804293 2:16690594-16690616 CTTAATATACAAGGAGGCTAGGG + Intergenic
926951857 2:18251887-18251909 CTGCATATCCATGTGGATTATGG - Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927398193 2:22680186-22680208 CTGAATATCCAGGTGGGCTTTGG - Intergenic
927932621 2:27054941-27054963 CTGAATCTGCAAGTGGAGCAGGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929088027 2:38187825-38187847 CTCAACATGCAAGTGTACTATGG - Intergenic
929573129 2:43035554-43035576 CTGAAGATAAGAGGGGACTACGG + Intergenic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
931642356 2:64392996-64393018 CAGAAAATACAAGGAGACTATGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
934631309 2:95926674-95926696 TTGAATATACAACTGAACTCAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935862750 2:107350644-107350666 CTGACTATACTATAGGACTAAGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936971896 2:118184305-118184327 CTGAATATACAAGTGCAGGCAGG + Intergenic
937658646 2:124405442-124405464 CTGCATATATAAGTGGAGTCCGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946498126 2:220216729-220216751 CTGAATATATATGTGGAGTCCGG + Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172460112 20:35111323-35111345 CTGAATAATGAAGTGGACTGTGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174920221 20:54694204-54694226 CTGAATATGGAAGTGGCCTCAGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175638015 20:60601763-60601785 GAGAATATACAAGTGGACTACGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180424741 22:15161893-15161915 CAGAATCTACAAGTGGTCTTTGG - Intergenic
1183166019 22:36148050-36148072 GTGAATATGGAAGTGGAATAAGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951896837 3:27617607-27617629 CTGCATTTACAAGTGGGATAGGG + Intergenic
952546551 3:34426158-34426180 CTGAAAATACAAGAGGACCAAGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956344399 3:68262096-68262118 CTCAATCTCCAAGTGAACTAAGG + Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
961153898 3:124662703-124662725 GTGAACATACAAGTTTACTAGGG + Intronic
962316608 3:134363432-134363454 CTGAACGCACAGGTGGACTAGGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964898346 3:161625623-161625645 CTGAATATATAAGTTGAAGAAGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966525530 3:180914879-180914901 GTGCATATGCAAGTGGATTATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974521761 4:62989898-62989920 ATGTATATACATGTGGACTAAGG - Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
979880807 4:125957177-125957199 CTGAATAAAAAAGAGGACCATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981910342 4:149972721-149972743 GTGAATAAATAAGTAGACTATGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
986230095 5:5855395-5855417 TTGAAGATACAAGTGTACTCAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
995745973 5:115403811-115403833 CTGAAAATACACGTGTACTGGGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000211466 5:159110094-159110116 ATGTATCTGCAAGTGGACTAAGG - Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003722061 6:8714831-8714853 CTGAGGATATATGTGGACTAGGG + Intergenic
1003869223 6:10388815-10388837 CTGAATCTGAAAGTGGACCAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006420943 6:33933675-33933697 CTTAATATACAATTGGTTTAAGG - Intergenic
1008357556 6:50572630-50572652 ATGAAGATACAAGTAAACTAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1010495081 6:76524441-76524463 CTGAATATACAAGAGCTCTCAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013648136 6:112165573-112165595 CAGAATATAAAAGAGGACTATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015083027 6:129251630-129251652 CTGAAAATAAAAGTCTACTAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017256685 6:152341164-152341186 TTGAATGTACAAGCGAACTATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018117848 6:160605544-160605566 CTGAATGTTCATGAGGACTATGG + Intronic
1018162082 6:161054695-161054717 CTGCCTATTCAAGTGGACTCTGG - Intronic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1022838451 7:34138939-34138961 ATGAATATAAATGTAGACTATGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1027729705 7:81855554-81855576 CTGAAAAAACAAGTAGACTTAGG + Intergenic
1027976964 7:85171002-85171024 CTCAATATATAAGTATACTAAGG + Intronic
1028110943 7:86940445-86940467 ATAAATATACAAGTGGGCTGAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036277078 8:7363453-7363475 GTGAAAATAAAAGTGGAGTAAGG - Intronic
1036344256 8:7946893-7946915 GTGAAAATAAAAGTGGAGTAAGG + Intronic
1036704094 8:11033773-11033795 CTGAAGATACGAGTGGACCTGGG - Intronic
1036861389 8:12353905-12353927 GTGAAAATAAAAGTGGAGTAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1040969542 8:53119584-53119606 CTGCAAATACAACTTGACTATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043711326 8:83422527-83422549 CAGAATACACCAGAGGACTAGGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045334289 8:101184593-101184615 CTGCATATGCCAGTGGGCTATGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1046194846 8:110848442-110848464 CTGAAAATACAGGTGGATTCAGG - Intergenic
1046493626 8:114985382-114985404 CTGCATAAACAAGTGGGCGAAGG - Intergenic
1048175149 8:132145224-132145246 CTGTATATACAAGTTGAACATGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1052244229 9:26314219-26314241 CTGAATATAGAAATGGTCTTGGG + Intergenic
1052254335 9:26436556-26436578 CTCAACATACAAGTAAACTACGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055194096 9:73565615-73565637 CTGAAGATAAAAGTGGCTTAAGG - Intergenic
1055953025 9:81748404-81748426 CTGAATTTACATTTGAACTATGG - Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059773789 9:117454101-117454123 CTGAATACAAGAGTAGACTAAGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187756849 X:22537563-22537585 CTGGATATAAAATTGGAATAGGG + Intergenic
1189132571 X:38515666-38515688 CTTAACAAACAAGTGGACTGAGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194199967 X:90942270-90942292 CAGAATGTAAAAGTGGACTTGGG + Intergenic
1194805708 X:98325035-98325057 CTGAATGTACATCTGTACTATGG + Intergenic
1195150176 X:102059765-102059787 TTGAATGTTCAAGGGGACTAAGG - Intergenic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1199326888 X:146509827-146509849 GTGACTAAACAAGTGGACTGTGG + Intergenic
1199665510 X:150093519-150093541 CTAAATAACCAAGTGGAATATGG - Intergenic
1200545960 Y:4518686-4518708 CAGAATGTAAAAGTGGACTTGGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic