ID: 912669996

View in Genome Browser
Species Human (GRCh38)
Location 1:111616689-111616711
Sequence TCCCCAGCAAAACTCAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912669993_912669996 -7 Left 912669993 1:111616673-111616695 CCCCTCTCATAGGCTTTCCCCAG No data
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
912669995_912669996 -9 Left 912669995 1:111616675-111616697 CCTCTCATAGGCTTTCCCCAGCA 0: 1
1: 0
2: 1
3: 13
4: 187
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
912669990_912669996 11 Left 912669990 1:111616655-111616677 CCTTACATAATACTCCTACCCCT No data
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
912669994_912669996 -8 Left 912669994 1:111616674-111616696 CCCTCTCATAGGCTTTCCCCAGC No data
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
912669989_912669996 12 Left 912669989 1:111616654-111616676 CCCTTACATAATACTCCTACCCC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182
912669992_912669996 -3 Left 912669992 1:111616669-111616691 CCTACCCCTCTCATAGGCTTTCC 0: 1
1: 0
2: 3
3: 20
4: 225
Right 912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912669996 Original CRISPR TCCCCAGCAAAACTCAGACC TGG Intronic
900799898 1:4730808-4730830 TCTCAAGCAATGCTCAGACCTGG + Intronic
902767556 1:18627552-18627574 TCCCCAGCTAAACTCAAGCTGGG + Intergenic
903789811 1:25885202-25885224 TTCCCAGGAAAACTCCCACCAGG + Intronic
904573374 1:31484708-31484730 CCCCCAAAAAAATTCAGACCAGG - Intergenic
905803032 1:40857820-40857842 TCCCCAGCTAAGCTCATCCCTGG - Intergenic
905922806 1:41730483-41730505 TCCCCATCAGCACTCAGTCCTGG + Intronic
907490277 1:54805030-54805052 TCCCCAGCACAGCTGAGAGCTGG - Intergenic
909828716 1:80158510-80158532 TCACCAGAAAAACTCACACCGGG + Intergenic
912050264 1:105521087-105521109 TCCCAAGCAAGACTAAAACCTGG + Intergenic
912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG + Intronic
914771038 1:150685285-150685307 ACCCCAGCAAAGCTCACTCCTGG - Intronic
916075323 1:161197201-161197223 GCCCCAGCCACACTCAGGCCTGG - Intronic
916524343 1:165595307-165595329 TTCCTAGGAAACCTCAGACCAGG - Intergenic
918377910 1:183927639-183927661 ACCCCAGCACAGCTCAGACTTGG - Exonic
920313953 1:205064861-205064883 TCCCAAGCAAAACTGAATCCTGG - Intronic
922551765 1:226499170-226499192 GCCCCAGCAAACCCCAGACCAGG + Intergenic
922864714 1:228849768-228849790 TCCTCAGCAATACAAAGACCAGG + Intergenic
922917768 1:229272034-229272056 TCCCCTGCAGCACCCAGACCTGG + Intronic
924193409 1:241579382-241579404 TGCCCAGCACAACTCTGACCTGG - Intronic
1064218729 10:13421427-13421449 TCCCCAGCAAATCTCAGTGGAGG - Intergenic
1065253234 10:23838032-23838054 TTCTCAGCAAACCTAAGACCTGG + Intronic
1066478169 10:35768574-35768596 TCCCCAGGAAAATTCAGCTCTGG + Intergenic
1066642040 10:37563900-37563922 TTCCCAGCATTACTCATACCAGG + Intergenic
1067048842 10:43000673-43000695 TCCCCTGCAAAATCCAGGCCAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068959000 10:62847721-62847743 TCTCCTAGAAAACTCAGACCTGG + Intronic
1070598425 10:77849079-77849101 TCCCCAGCAAAACACACATATGG + Intronic
1070780410 10:79134315-79134337 TTCCCAGCAAAACAGTGACCAGG + Intronic
1071374746 10:84991076-84991098 TCCCCAGCCAGACTGAGACCTGG - Intergenic
1071915296 10:90288714-90288736 ACTCCAGGAAAACTCTGACCAGG + Intergenic
1072636636 10:97182612-97182634 TCCCCAGGATAACTCACCCCTGG + Intronic
1074371947 10:112907340-112907362 TCCCCAGCCAAAGTCAGCCCTGG + Intergenic
1076564600 10:131389568-131389590 TCCCCAACAAAACTCATCCAGGG + Intergenic
1076636203 10:131883858-131883880 ACCCCAGAAAAACTCACCCCAGG + Intergenic
1079420988 11:20287848-20287870 TCCAAACCAAAGCTCAGACCAGG - Intergenic
1080708757 11:34725180-34725202 TACCCAGCAAAACTAAGTTCAGG + Intergenic
1082988405 11:59186866-59186888 TCCCCAGGATAAATCAAACCAGG - Intronic
1083705380 11:64510662-64510684 TCACCAGGAATCCTCAGACCCGG - Intergenic
1083936077 11:65870854-65870876 TCCCCAGCAACACTGATTCCTGG + Intronic
1084708772 11:70831085-70831107 CCCCCAGCCCAACTCACACCTGG - Intronic
1084794788 11:71497902-71497924 GCCCCAGCAAGACTCACAACAGG - Intronic
1084936168 11:72587877-72587899 ACCCCAGCAGACCTCAGGCCCGG + Intronic
1089216329 11:116836810-116836832 TCCCCTGCAAAGGACAGACCAGG - Intronic
1089638889 11:119833958-119833980 TCCTCAGGAGAACTCAGACCTGG + Intergenic
1090995494 11:131862120-131862142 TCCCCAGATCAACTGAGACCTGG - Intronic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1095356991 12:41286463-41286485 TCCCCAGCTAATCCCTGACCTGG + Intronic
1101252832 12:102952117-102952139 TCCCCAGAAACACTCTGACAAGG + Intronic
1101388194 12:104276530-104276552 TCCCCACCACCACTCAGAACTGG + Intronic
1102345993 12:112161788-112161810 TCCTCAGAAAAACCAAGACCGGG + Exonic
1104908435 12:132228024-132228046 TCCCCAGCAGACCACAGAGCAGG - Intronic
1106311767 13:28560942-28560964 TCCCAAGCAACAATCAGACATGG - Intergenic
1106955041 13:34928003-34928025 TTACCAGCAAACCTCAGGCCAGG - Intergenic
1107987420 13:45787261-45787283 GCCCCATCAAAACTTAGCCCAGG - Intronic
1109141334 13:58716265-58716287 TCCCCAGAAAAATTCACTCCTGG - Intergenic
1110610204 13:77479420-77479442 TCCCCAGAAAAAGTCAAACTTGG + Intergenic
1115780471 14:36763227-36763249 TCCAGAGAAAAACTCAGATCTGG - Intronic
1115882324 14:37933356-37933378 TCCCCAGTAGAACTGAGCCCTGG - Intronic
1119567320 14:75639788-75639810 GCAGCAGCAAAACTGAGACCAGG - Intronic
1119806759 14:77487323-77487345 CTGCCAGCAGAACTCAGACCAGG - Intronic
1122491397 14:102118189-102118211 GCCCAAGCAAAATTCAGACAAGG + Intronic
1123067557 14:105626242-105626264 CCCCCAGCCAAAGTCAGGCCCGG + Intergenic
1125503387 15:40252946-40252968 TCTCCAGCCACACTCCGACCCGG - Intronic
1125968171 15:43890941-43890963 TCCCCAGCAGAACGCTGACTAGG + Intronic
1126442346 15:48703150-48703172 TCCCCACCAAAACACAGCCTAGG + Intergenic
1128570244 15:68728442-68728464 TCCCCAGCCAGACTCAGAGCTGG + Intergenic
1128608967 15:69058708-69058730 TCACCAGGGAAACTCACACCTGG + Intronic
1129418163 15:75400698-75400720 TCCCTAGCAAAGATCAGCCCTGG - Intronic
1132216126 15:100062990-100063012 ACCCCAGCAAAGGTCAGCCCAGG - Intronic
1134081648 16:11328850-11328872 CCCCCAGAAAACCTCATACCAGG + Intronic
1134568161 16:15268905-15268927 TCACCCGCAAAATCCAGACCTGG + Intergenic
1134734272 16:16487450-16487472 TCACCCGCAAAATCCAGACCTGG - Intergenic
1134933229 16:18224829-18224851 TCACCCGCAAAATCCAGACCTGG + Intergenic
1138298298 16:55905715-55905737 TCCCCAGGAAAACACTGTCCTGG + Intronic
1138338455 16:56271004-56271026 TCACCTCCACAACTCAGACCTGG + Intronic
1142158536 16:88545171-88545193 CCCTCAGCAAACCTCAGACTTGG + Intergenic
1147426482 17:40348149-40348171 TCCCCAGCCAGACTCAGGGCAGG - Intronic
1147596456 17:41721131-41721153 TTCCCAGCAGGACTGAGACCCGG + Intronic
1147660152 17:42113008-42113030 TCCCCAGCAAGCCTCAGGCCTGG - Intergenic
1149552508 17:57550755-57550777 TTCCTAGGAAAACTCAGAGCAGG + Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG + Intergenic
1152104763 17:78322583-78322605 TCCCAAGCAAGCCTGAGACCAGG - Intergenic
1152526182 17:80889497-80889519 TCCCCAGCAGCACACAGACGGGG - Intronic
1153764550 18:8363035-8363057 TCCCCAGCAATGCCCAGTCCGGG + Intronic
1155103174 18:22634189-22634211 ACCCCAGCAACACTCAGAAAAGG - Intergenic
1157047819 18:44124061-44124083 TACCCAGTAAAACACAGAGCTGG + Intergenic
1158393671 18:57063426-57063448 GCAACAGCAAAACTCAGCCCTGG - Intergenic
1161175031 19:2836846-2836868 TCCCTAGCAAAATCAAGACCAGG + Intergenic
1161434036 19:4251205-4251227 CCCCCAGCACACCTCAGATCAGG + Intronic
1162834148 19:13305171-13305193 TCCCCAGCAAGACCAAGCCCCGG - Intronic
1163090370 19:15015257-15015279 TCTCCAGCAATATTCAGACTAGG - Intronic
1163258120 19:16170154-16170176 TCCCCAAGAACACTCAGCCCTGG + Intronic
1166046787 19:40234716-40234738 TCCCCAGCATAGCCCAGCCCTGG + Intronic
1167077616 19:47258871-47258893 TCCCCAGCACCACTCAGCACTGG - Intronic
925295318 2:2772597-2772619 CCTCCAGCCAAACTTAGACCAGG + Intergenic
925784071 2:7411524-7411546 TCCACAGCGAAACTGAGATCAGG - Intergenic
926484922 2:13442309-13442331 ACCACATAAAAACTCAGACCAGG - Intergenic
927807263 2:26159074-26159096 TCCCCACCAACACATAGACCAGG - Intergenic
928430847 2:31217331-31217353 TCACCTGCAAAGCTCAAACCAGG + Intronic
928441582 2:31296698-31296720 TCCACAGCAATACTGTGACCTGG + Intergenic
928935934 2:36678035-36678057 CCCCCAGCAGAGCTCAGTCCTGG - Intergenic
930865647 2:56119921-56119943 TGCCCAGGAAAACTAAGACCTGG - Intergenic
931352573 2:61505183-61505205 GCCCCAGCAACAATGAGACCAGG - Intronic
933512997 2:83264673-83264695 TCCTCAGCAATACAGAGACCTGG + Intergenic
933656638 2:84894101-84894123 TACCCAGGAGAAATCAGACCAGG + Intronic
933803733 2:85983068-85983090 TCCCCAGCACCCCTCTGACCGGG + Intergenic
935622682 2:105143611-105143633 TGAGCAGCAAAACTGAGACCTGG - Intergenic
942089743 2:172478446-172478468 TCCCCACCAGAACTCAGAATGGG - Intronic
948225163 2:236304114-236304136 TCCTCAGCAAATTTCAGACCTGG - Intergenic
1169190808 20:3658278-3658300 ACCACACCAAAACTCAGGCCTGG - Intergenic
1171781095 20:29418838-29418860 TCTCAGGCAAAACTCAGGCCTGG + Intergenic
1173290933 20:41714744-41714766 CTCCCAGCAAACCTCAGCCCTGG + Intergenic
1175950332 20:62580274-62580296 TCCCCAGCAAACCTCACTCATGG - Intergenic
1177096392 21:16839520-16839542 TCCCCCTAAAAACCCAGACCAGG + Intergenic
1177788582 21:25697444-25697466 TATCCAGCAAAACCCAGAACTGG - Intronic
1180859639 22:19070362-19070384 TCTCCAGCCACACTCAGGCCTGG - Intronic
1181286397 22:21755391-21755413 TTCCCAGCAACACTGAGTCCAGG + Exonic
1181396664 22:22627947-22627969 TCCCCTTGAAAACTCAGAACTGG - Intergenic
1181704789 22:24643504-24643526 TCCCCTTGAAAACTCAGAACTGG - Intergenic
1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG + Exonic
1182897754 22:33873122-33873144 TCCCCAGCAAAAGGGAGGCCCGG + Intronic
1184431788 22:44445361-44445383 TCCCCAGCACCACCCAGCCCCGG + Intergenic
950867631 3:16201847-16201869 TACCCAGGAAAACTGAAACCTGG + Intronic
950949924 3:16987346-16987368 TACCAAGCAGAACTCAGCCCTGG - Intronic
952743380 3:36756182-36756204 TTCCCAGCAGAACTGAGCCCAGG - Intergenic
952971953 3:38656919-38656941 TACCCTACAAAGCTCAGACCTGG - Intergenic
954966669 3:54617505-54617527 TCCCCAGAAATACTCTGATCAGG - Intronic
955059215 3:55482058-55482080 TCTCCAGCCCAACTCAGACTTGG + Intronic
955303943 3:57810391-57810413 ACCCGAGCAAAACTCAGGCAAGG + Intronic
959681202 3:109098519-109098541 GCCTCAGCAAGTCTCAGACCTGG - Intronic
960951495 3:123001277-123001299 TCCACAGAAAAACTCACCCCAGG - Intronic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
965942882 3:174206833-174206855 TACCCAGCAAAACCCAGCGCAGG + Intronic
967096061 3:186178301-186178323 CCCACAGCAAAACTCCGTCCTGG - Intronic
967867007 3:194198480-194198502 TCCCCAGCAGCACTCAGCCATGG - Intergenic
970910789 4:21272494-21272516 TTGGCAGCAAAACTCAGGCCTGG + Intronic
972855958 4:43106833-43106855 TTGCCAGAAAAACTCAGACCTGG - Intergenic
975696997 4:77023226-77023248 TCAAAAGCAAAACTCAGGCCAGG - Intronic
975827507 4:78335224-78335246 TGCCCAGCAATCCTCAGAACTGG - Intronic
975846117 4:78526822-78526844 TCCCCAGCTGAAGTCAAACCTGG + Intronic
980154841 4:129092091-129092113 TTCCCCGTAAAAATCAGACCGGG + Intronic
980663577 4:135899346-135899368 TCCCCACCAAACCCCTGACCAGG + Intergenic
980807189 4:137828823-137828845 TCCCCAGCAAATTTCACAGCTGG + Intergenic
982194429 4:152896046-152896068 TCCCCCGCAACACACACACCTGG - Intronic
984167738 4:176321928-176321950 TCCCTAACAAAACTCAGAAGGGG - Intronic
987707717 5:21476698-21476720 TCCTCAGCAAAATTCTGACCAGG - Intergenic
989066239 5:37465118-37465140 TCCTTAGCAAAATTCTGACCAGG - Intronic
990531402 5:56676964-56676986 TCAGTAGCAAAACTCAGAGCAGG - Intergenic
994419778 5:99517666-99517688 TCCTTAGCAAAATTCTGACCAGG - Intergenic
994487432 5:100397475-100397497 TCCTTAGCAAAATTCTGACCAGG + Intergenic
1001064842 5:168528436-168528458 TCCTCAGGGAAAATCAGACCTGG + Intergenic
1006560677 6:34909261-34909283 TCTCCCGTAAAACACAGACCTGG + Intronic
1007687269 6:43674237-43674259 TCCCCACCAGAACTCAGGCATGG - Intronic
1008374539 6:50777189-50777211 TGCCCAGCACAAGCCAGACCAGG + Intergenic
1009020498 6:57943837-57943859 TCCTTAGCAAAATTCTGACCAGG + Intergenic
1014452370 6:121596267-121596289 TCCCCAGAGAAACTCCAACCGGG + Intergenic
1014761698 6:125363840-125363862 TCAGCAGCAAAAGTCAGCCCTGG - Intergenic
1016426159 6:143937669-143937691 TCTGGAGCAAAACTCAGACAAGG + Exonic
1017194421 6:151684624-151684646 TCCCCAGAATATCTCAGCCCAGG + Intronic
1017833949 6:158159478-158159500 TCTCCAGCAAGAGTGAGACCCGG + Intronic
1019136365 6:169911174-169911196 TGCCCAGCAAAAGGCAGGCCCGG - Intergenic
1019303826 7:322863-322885 TCCTCAGCAAACCTCTGGCCTGG - Intergenic
1021809565 7:24390188-24390210 CCCTCAGCAAAACACAGCCCTGG + Intergenic
1021884179 7:25122212-25122234 TCCCCACCAGAACTCAGACTAGG + Exonic
1022822876 7:33978431-33978453 TCCCCAGCAAGACTAAGCTCTGG - Intronic
1023178237 7:37454429-37454451 TACCCAGCAAAACTCGAAACAGG - Intergenic
1023817994 7:43964856-43964878 TTCCCTGCAGACCTCAGACCAGG - Intergenic
1024284011 7:47741554-47741576 TCCACAGAAAAACTCACACAGGG - Intronic
1029561096 7:101303324-101303346 TCCCCAGGAAAGCTCAGGCGGGG - Intergenic
1029575721 7:101402068-101402090 TCCCCTGCAAAGGTCAGGCCCGG - Intronic
1029742620 7:102499727-102499749 TTCCCTGCAGACCTCAGACCAGG - Intronic
1029760610 7:102598892-102598914 TTCCCTGCAGACCTCAGACCAGG - Intronic
1032245221 7:130205594-130205616 TAAGCAGCAAAATTCAGACCAGG + Intronic
1032396140 7:131591557-131591579 TCCACAGCAACTCTTAGACCAGG + Intergenic
1034328888 7:150265106-150265128 TACCCAGCCAAACTGAGAGCTGG + Intronic
1034346686 7:150389581-150389603 TCCCCAGATAGACTCATACCTGG + Intronic
1034669159 7:152844639-152844661 TACCCAGCCAAACTGAGAGCTGG - Intronic
1035126305 7:156610320-156610342 TCCCCAGCAAGGCGCACACCAGG - Intergenic
1036294760 8:7527010-7527032 TCCCCAGCAAACCACAAAGCTGG + Intergenic
1036327803 8:7793981-7794003 TCCCCAGCAAACCACAAAGCTGG - Intergenic
1041914961 8:63129469-63129491 TTCCCAGCTGAACTCAAACCAGG + Intergenic
1042630414 8:70809416-70809438 TCACCAGCAAAGCTCAAAGCTGG + Intergenic
1044732203 8:95238352-95238374 TCTCCAGCAAAACTGAAGCCTGG + Intergenic
1049352954 8:142173938-142173960 TCCCCATCGAAATTCAGAGCAGG - Intergenic
1049787098 8:144456230-144456252 TCCCGACCAACACTCAGCCCAGG + Intronic
1052230601 9:26146180-26146202 TCCCCGGAAAAACTCCAACCAGG - Intergenic
1052805273 9:33007852-33007874 TCCCCACCAAGACTGAGCCCAGG + Intronic
1057351475 9:94302203-94302225 TCCCAAGCAAGTCTCAAACCTGG + Intergenic
1057857791 9:98615277-98615299 TCCTCAGTAAATCTCACACCAGG - Intronic
1059432237 9:114257250-114257272 TCCGCAGCAATTCTCAGACTGGG - Intronic
1062147723 9:134999308-134999330 CACCCAGCATAACTCATACCTGG + Intergenic
1185783214 X:2867063-2867085 TCCCCAGCACTACCCAGACAGGG - Intronic
1186665576 X:11713580-11713602 TTCCAAGCAAAACTCAAAACTGG + Intergenic
1188129480 X:26413476-26413498 TCCCCAGAAGAACTCTGACAAGG - Intergenic
1189573100 X:42320767-42320789 TCCCCAGCCACACTCAGAAGCGG + Intergenic
1198129000 X:133675462-133675484 TCCTGAGCAAAACTCTGTCCTGG + Intronic
1201187003 Y:11414431-11414453 TCCCTAGCAAAAAACAGAGCTGG + Intergenic