ID: 912670560

View in Genome Browser
Species Human (GRCh38)
Location 1:111620201-111620223
Sequence GAGGGGCCCCGGCCGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912670546_912670560 11 Left 912670546 1:111620167-111620189 CCCGGTCGACTGTAGGCCTGCGG No data
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670543_912670560 22 Left 912670543 1:111620156-111620178 CCGCGGACCGACCCGGTCGACTG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670542_912670560 23 Left 912670542 1:111620155-111620177 CCCGCGGACCGACCCGGTCGACT 0: 1
1: 0
2: 0
3: 1
4: 9
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670541_912670560 28 Left 912670541 1:111620150-111620172 CCACGCCCGCGGACCGACCCGGT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670548_912670560 10 Left 912670548 1:111620168-111620190 CCGGTCGACTGTAGGCCTGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670553_912670560 -5 Left 912670553 1:111620183-111620205 CCTGCGGGAGACCGTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219
912670545_912670560 15 Left 912670545 1:111620163-111620185 CCGACCCGGTCGACTGTAGGCCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912670560 Original CRISPR GAGGGGCCCCGGCCGGCTGT GGG Intronic
900191726 1:1354985-1355007 GCGGGACCCCGGGCGGCTGCCGG + Exonic
900227750 1:1540766-1540788 GAGGGGTCCCGGCCGGCGTCCGG - Intergenic
900460349 1:2799686-2799708 GAGGGGGCCAGGGCGACTGTCGG - Intronic
901829210 1:11881818-11881840 GAGGAGCCCTGGCAGGCTGGTGG + Intergenic
902385489 1:16073396-16073418 GAGGGGGCCCGGCCGGGGGCGGG - Intronic
902449028 1:16485042-16485064 GAGGGCCTCGGGCCTGCTGTGGG - Intergenic
902468417 1:16631749-16631771 GAGGGCCTCGGGCCTGCTGTGGG - Intergenic
902505723 1:16938242-16938264 GAGGGCCTCGGGCCTGCTGTGGG + Intronic
902779052 1:18692899-18692921 GAGGGGCAAAGGCCTGCTGTAGG + Intronic
903154710 1:21435909-21435931 GAGGGTCTCGGGCCTGCTGTGGG + Intergenic
904003133 1:27349779-27349801 GAGGGGACCCGGGCGGCCGGGGG + Intronic
904030053 1:27528063-27528085 GAGGGAGCCCGGCCGGCAGGGGG + Intergenic
904215329 1:28914518-28914540 GAGGGGCGCGGGCCGGCGGGCGG + Intronic
905401679 1:37708236-37708258 GAGGGGCTCAGGCTGACTGTGGG + Intronic
905442818 1:38005633-38005655 GAGGGGGCCGGGCCGACTGGCGG - Intergenic
906637104 1:47416925-47416947 GAGGGGCCCGGTCCGGCAGAAGG - Exonic
906654000 1:47534327-47534349 GAGGGGCAGTGGCTGGCTGTGGG + Intergenic
912670560 1:111620201-111620223 GAGGGGCCCCGGCCGGCTGTGGG + Intronic
915149128 1:153815753-153815775 GGCTGGCCCCGGCCGGCTGACGG + Intronic
915313826 1:155017358-155017380 GAGGGGCCCCGCCCAGCTAGGGG + Exonic
915343283 1:155187674-155187696 GAGGGGCCCCGGCATGGTGCTGG + Intronic
916101812 1:161399509-161399531 GCGGCGCCCCTGGCGGCTGTGGG - Intergenic
916587819 1:166164231-166164253 CAGGGGCCCCAGGCTGCTGTGGG + Intronic
916694600 1:167221898-167221920 GCGCGCCCCCGGCCGGCGGTCGG + Intronic
922496485 1:226062197-226062219 GAGGAGACCCGGGCGGCAGTGGG - Intronic
922696909 1:227735457-227735479 GAGGCGCCGCGGTCGGCTCTGGG + Exonic
923660104 1:235950411-235950433 GAGCTGCCCCTGCCGTCTGTCGG + Intergenic
1062896076 10:1104332-1104354 GAGGAGCCCCGGCTGGCAGCTGG - Intronic
1064651165 10:17511308-17511330 GAGGGGACCCAGCCTGCTGGAGG + Intergenic
1067048756 10:43000248-43000270 GGGAGGCCCAGGCTGGCTGTGGG - Intergenic
1067655502 10:48188554-48188576 GAGAGTCCCCAGCCTGCTGTGGG + Intronic
1070660717 10:78303459-78303481 GGGGCGGCCCGGCCGGCTGGAGG - Intergenic
1070877259 10:79826013-79826035 GAGGGGTCCCGGGCGGCGGGCGG - Intergenic
1070923826 10:80205314-80205336 GAGGGTCCCGAGCCGGCTGGGGG - Intronic
1071643756 10:87342057-87342079 GAGGGGTCCCGGGCGGCGGGCGG - Intergenic
1072990271 10:100186025-100186047 GAGTGGGCGGGGCCGGCTGTTGG - Exonic
1073338681 10:102729270-102729292 GTGGGGCCCCTGCCGGCTGAGGG - Intronic
1076478016 10:130766186-130766208 GAGGTGCCCTGGTCGGCTGAGGG + Intergenic
1076661511 10:132058691-132058713 GAGGGGACGCACCCGGCTGTTGG + Intergenic
1076874088 10:133207536-133207558 GAGTGGCCTCCGCCGCCTGTGGG + Intronic
1076889163 10:133275559-133275581 GAGGGCCCAGGGCCGGCTGGGGG + Exonic
1077061724 11:620484-620506 GAGGGGCCCAGTCCCGCTGGTGG + Intronic
1077254246 11:1573322-1573344 GGGGGGCCCAGGCTGGCTGGGGG - Intergenic
1078476579 11:11635309-11635331 GAGGGACCCTGGCTGGGTGTGGG - Intergenic
1080036743 11:27719394-27719416 GAGGGGGCCTGGGCGGCTGGAGG - Intronic
1080258823 11:30323341-30323363 GAGAGGCCCCGGCCAGCAGCTGG - Intronic
1080283803 11:30586109-30586131 GAGCGGCCCGAGCCGGCTGGAGG + Intronic
1080588323 11:33700487-33700509 GAGGGACCCAGGCCGGGTGGTGG + Exonic
1080897800 11:36460805-36460827 GAGGTGCCCCGGCAGGCAGATGG - Intronic
1083614938 11:64021633-64021655 GAGGGGCCCCAGCCAGGAGTTGG + Intronic
1083806871 11:65079575-65079597 CAGGGTCTCCAGCCGGCTGTAGG + Exonic
1083970204 11:66070044-66070066 GCGGGGCCGCGGCCGGCCGTGGG + Intergenic
1084502990 11:69545860-69545882 GAGGGGCTACGGGAGGCTGTGGG - Intergenic
1084706845 11:70820633-70820655 GGGGGGCCGCCGCCGGCGGTTGG + Intronic
1088687638 11:112298306-112298328 GAGAGCCCCCGGCAGGCTGATGG + Intergenic
1088907359 11:114164752-114164774 GAGGGGCCCCACCCTGCTTTGGG + Intronic
1091273051 11:134331744-134331766 GCGGGGCCCCGGCCGGGGGCGGG - Intergenic
1091345189 11:134847596-134847618 GAGGGGTCCCGGCCTGCGGTGGG + Intergenic
1092229000 12:6766628-6766650 GAGGGGCCCTGGACGGCGGAGGG - Exonic
1092861902 12:12725649-12725671 GAGGGGCCCCGGGCGGGCGCGGG - Intergenic
1096106312 12:48998570-48998592 CAGGGGCCCCGCCCGCCAGTTGG + Exonic
1096716230 12:53493094-53493116 GAAGGGACACGGCCGGCTGGGGG + Intronic
1101618203 12:106358326-106358348 GAGGCACCACAGCCGGCTGTGGG + Intronic
1103563461 12:121804254-121804276 GAGAGGCCGCGGCCGGCAGCCGG + Intronic
1105022966 12:132829242-132829264 GAAGGGCGCCGGCCGGGTGGAGG - Intronic
1105417132 13:20223244-20223266 GAGGGCCCACAGCCGGATGTGGG + Exonic
1112002352 13:95222511-95222533 GAAGGGCCCCAGAAGGCTGTGGG + Intronic
1112924978 13:104662764-104662786 GAGGGGACCCGGAGGGCTATGGG + Intergenic
1113911244 13:113842447-113842469 ATGGGGCCCCGGCCGGCTCCTGG - Intronic
1114553923 14:23550885-23550907 GGCGGCCCCCCGCCGGCTGTGGG - Intronic
1114674269 14:24430270-24430292 GAGGGGCAGCGGACGGCTGGGGG + Intronic
1117119606 14:52553187-52553209 GAGGGCTCGCGGCCGGCTGCGGG - Exonic
1121304591 14:92898146-92898168 GAGGGGTGCAGGCAGGCTGTGGG + Intergenic
1121667877 14:95686356-95686378 GTGGGGCCCGGGCCGGCAGTGGG - Intergenic
1122151209 14:99727076-99727098 GAGGGGCCCCTGCCGGCGGGGGG - Exonic
1122558399 14:102593331-102593353 TAGCGGCCCCGGCCGGCCGGCGG + Intronic
1122634490 14:103123672-103123694 GAGGGGCCAAGGCTGGCTGAGGG + Exonic
1122640641 14:103157125-103157147 GAGAGGCCCCGGCCCACTGTGGG + Intergenic
1123758805 15:23417039-23417061 GCGGGGCCCCAGCCGCCTGGGGG + Intergenic
1125721634 15:41847853-41847875 CAGGGGCCCCGGCCATCAGTGGG - Exonic
1127303302 15:57678718-57678740 GAGTGGCCCCTGCGTGCTGTAGG + Intronic
1128322122 15:66701488-66701510 GAGGGGGCCCGGCCGGCCGGCGG + Intergenic
1129298930 15:74614733-74614755 GCGGGGCCGCGGCTGGCTGGCGG + Intronic
1130520494 15:84657748-84657770 AAGGGGCACCGGCTGGCAGTGGG + Intronic
1132604777 16:789097-789119 GCAGGGACCCGGCCGGCTGCAGG - Exonic
1134656195 16:15949867-15949889 GGGGTGCCCCGGGCGGCTGCGGG - Intronic
1136220285 16:28823752-28823774 GAGGGGCCGCGCTCGGCTCTCGG + Intronic
1136779162 16:32886180-32886202 GAGGGGGGCCGGCCAGCCGTGGG - Intergenic
1136891455 16:33975338-33975360 GAGGGGGGCCGGCCAGCCGTGGG + Intergenic
1138550207 16:57743707-57743729 GAGAGACCCCGGCAGGCTGGAGG - Intronic
1139374273 16:66487063-66487085 GAGGGGCCCCAGCCAGCTGCAGG + Intronic
1139853169 16:69962626-69962648 CAGGGGCACAGGCCGGCTGTTGG - Intronic
1139882140 16:70185534-70185556 CAGGGGCACAGGCCGGCTGTTGG - Intronic
1140370368 16:74409970-74409992 CAGGGGCACAGGCCGGCTGTTGG + Intronic
1140455444 16:75102753-75102775 GAGGAGGCCCGGCCAGCTGATGG - Intronic
1140908565 16:79430619-79430641 GAGAGGCCCAGGCCTGGTGTTGG + Intergenic
1142137973 16:88460255-88460277 GAGGGTCCCCAGCCTACTGTTGG + Intronic
1142349260 16:89572333-89572355 GAGGCGGCCACGCCGGCTGTTGG - Intergenic
1142350295 16:89576435-89576457 GAGGGGCGCCGGCCGACGGGGGG + Intronic
1203081574 16_KI270728v1_random:1148268-1148290 GAGGGGGGCCGGCCAGCCGTGGG - Intergenic
1143845916 17:9772608-9772630 TGGGGGCCCCGCCCTGCTGTTGG + Intronic
1144455852 17:15417844-15417866 GAGGGGCTCTTGTCGGCTGTGGG - Intergenic
1145881686 17:28357190-28357212 CAGGGGCCCGGGCCTGCTGAGGG - Intronic
1145936552 17:28717807-28717829 GAGGGGCCCAGTCCGGCTACAGG + Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148587954 17:48794243-48794265 GAGGGCCCAGGGCCTGCTGTTGG + Intronic
1149038139 17:52157911-52157933 GACTGTCCCTGGCCGGCTGTCGG - Exonic
1150389328 17:64781414-64781436 GAGGTGCCCGGGCAGGCAGTGGG - Intergenic
1150408126 17:64919717-64919739 GAGGAGGTCCGGCCGGCTTTGGG - Intergenic
1150488567 17:65560244-65560266 GAGGGGCCCGGGCCGGGAGGAGG + Intronic
1150747068 17:67825181-67825203 GAGGAGGTCCGGCCGGCTTTGGG + Intergenic
1152375665 17:79917606-79917628 GAGGTGCCACTTCCGGCTGTGGG + Intergenic
1153794423 18:8609573-8609595 GAGCGGCCCCGGCGGCCCGTGGG - Exonic
1160300741 18:77675719-77675741 GAGCGGCCCGGGGAGGCTGTTGG + Intergenic
1160454784 18:78992783-78992805 CAGGGGCCCCGGCCGACAGCGGG - Exonic
1160976840 19:1796890-1796912 CGGGGGCACGGGCCGGCTGTGGG + Intronic
1160999941 19:1905528-1905550 GAGGGGCGCCGGCCGTTTGTGGG + Intronic
1161620187 19:5293374-5293396 GCGGGGCCCCGGCCGGAAGTGGG + Intronic
1162552283 19:11364493-11364515 GAGGGGCCCTGGCTGGGGGTGGG - Exonic
1163607268 19:18281983-18282005 GTGGGGCCCCGGCCGGGCGGGGG + Intergenic
1163655218 19:18541913-18541935 GTGGGACCCCGGCGGGCAGTGGG + Exonic
1165940678 19:39413427-39413449 GAGGGGCCCAGGCGGACTGGGGG + Intronic
1166798596 19:45442839-45442861 GAGGGGCCACGCCCTGCTGCTGG - Intronic
1166798979 19:45444325-45444347 GAGGGGCGCGGGCCGGCCTTGGG - Intronic
1167252147 19:48405091-48405113 GTGGGGCCCCAGCTGGCTGGAGG + Exonic
1167348745 19:48962498-48962520 GGGGGGCCCCACCCAGCTGTGGG - Intergenic
1167426519 19:49432487-49432509 GCGGGGCCTGGGCCGGCTCTAGG - Intronic
1168189107 19:54725261-54725283 GAGGGGCCCTGGCCACATGTGGG + Exonic
925128295 2:1477092-1477114 GAGGAGGCCCGGCCGGCCGCGGG + Exonic
926802327 2:16669502-16669524 AAGGGGCCCCGGCCAGCAATTGG - Intergenic
928173407 2:29017915-29017937 GCGGGGCTCCTGCCGGCTGATGG - Exonic
928927965 2:36597848-36597870 GCGGGGCCCCGGCCGGGAGTGGG - Intronic
929575146 2:43046739-43046761 GAGGGCCCCAGGCTGGGTGTGGG - Intergenic
929589812 2:43137574-43137596 GAGGGGTCCCGGGTGGCTGGCGG - Intergenic
929778525 2:44943065-44943087 GAGGGGGCCGGGCTGGCTGTGGG + Intronic
931487265 2:62705863-62705885 GAGGGGCGCCGTCCGCCTGAGGG + Exonic
935277977 2:101492216-101492238 GAGGGGCCCAGGGCGCCTGTGGG + Intergenic
936049805 2:109214147-109214169 TAGGGGCCTCAGCAGGCTGTTGG + Intronic
936063540 2:109313604-109313626 TAGGGGCCCCGGCCAGCAGTGGG + Intronic
937896447 2:126979887-126979909 GAGGGGGCCCAGGCTGCTGTAGG - Intergenic
940639806 2:156333868-156333890 GAGGGGCCCGAGCTGGCTCTGGG + Intronic
946395494 2:219442021-219442043 GAGGGGGCCGGGCCGGCGGCCGG - Intronic
947885488 2:233566464-233566486 GGAGGGCCTCGGCCGGCCGTAGG - Intronic
948983777 2:241508233-241508255 GCGGGGCCCCGGCGGCCTGGGGG - Intronic
949046263 2:241873888-241873910 GAGGGGCCCCTGCAGGGTGGAGG - Intergenic
1168814627 20:728253-728275 GCGGGGCGCCGGCCGGCTTGGGG + Intergenic
1170572834 20:17642090-17642112 CAGGGGTCCCGGCAGGCTGATGG - Intronic
1173307248 20:41862349-41862371 GAGGGGCCACGCCAGGCTGGGGG + Intergenic
1173863675 20:46300408-46300430 GATGGGCCCGGGCAGGCTGATGG - Intronic
1173872554 20:46351036-46351058 CAGGGGACCCGGCCGGCTTGCGG + Intronic
1174317356 20:49713377-49713399 GAGGGATCCCGGGCGCCTGTTGG + Intronic
1174317388 20:49713479-49713501 AAGGGGCCCCGGCCGGGAGGCGG - Intronic
1175572367 20:60033692-60033714 GAGGGGCATGGGCCTGCTGTTGG + Intronic
1175940491 20:62535486-62535508 GAGAGGCCCGGGGCAGCTGTGGG + Intergenic
1180962084 22:19766665-19766687 GTAGGGCGCCGGCCGGCTCTTGG - Exonic
1181017644 22:20080399-20080421 GAGGGGCGCCCGCGGGCGGTTGG + Intronic
1181041505 22:20194744-20194766 GAGGGGCCTGGGCAGGCTGCTGG - Intergenic
1181054790 22:20255737-20255759 GAGGGGCCCCAGCCTGGAGTGGG - Intronic
1182451103 22:30422416-30422438 GAGGGGGCCAGGCCTGCTATAGG - Exonic
1182555801 22:31127725-31127747 GAGGGGCCCCGCCTTGCTGAAGG + Intronic
1183453281 22:37907820-37907842 GGTGGGCCCCTGCCCGCTGTGGG + Intronic
1183675520 22:39297039-39297061 GAGGTGCCCCGGCAGGCAGGCGG + Intergenic
1183697412 22:39431082-39431104 GAGGGGCCTCTGCCGGCTGAGGG + Exonic
1184164794 22:42720828-42720850 GCGGGGCCCCGGCGGGCGGGCGG + Intronic
1184225818 22:43128359-43128381 AAAGGGCCCCGGGTGGCTGTGGG + Intronic
1185267791 22:49913579-49913601 GAGGGGCCCCTGCTGTCTTTGGG - Intronic
1185321112 22:50200644-50200666 GTGGGGTCCCGGCCGCCCGTGGG + Intergenic
950399301 3:12758563-12758585 GAGGGGGCCCTGCTGCCTGTTGG - Intronic
950448139 3:13049995-13050017 CAGGGGCCACTGCCTGCTGTGGG - Intronic
950569878 3:13793285-13793307 GAGAGGCCCCGGCATGCTATCGG + Intergenic
950683335 3:14600554-14600576 GAGGGGCCCCAGCCAGCGGGAGG - Intergenic
951464839 3:22990488-22990510 GCGGGGCCCCGTCCGGCTAGTGG - Intergenic
952267592 3:31801542-31801564 CAGGGGCCTGGGCCTGCTGTGGG - Intronic
953972186 3:47356140-47356162 GAGGGGTCCGGGCTGGCTGAGGG - Intergenic
954616543 3:51971584-51971606 GAGAGGCCCTGCCCGGCAGTGGG - Exonic
954798378 3:53172925-53172947 GAGGGGACCAGGCCGGATCTGGG + Intronic
956487677 3:69739723-69739745 GAGGCGCACCGGGCGGCTGGGGG + Intronic
961360587 3:126364822-126364844 CAGGGGCCCTGGCTGGCTGCTGG + Intergenic
961988844 3:131166416-131166438 GAGGGGCCCTGTCTGGCTGAGGG - Intronic
962222360 3:133574204-133574226 GCGGGGACCCGGCCGGGTGACGG + Exonic
962318050 3:134371011-134371033 GTGGGGCCCCGGGAGGCAGTCGG - Exonic
968044802 3:195618021-195618043 GAGGGGCCTCGGCAGGGTGGGGG + Intergenic
968060586 3:195724073-195724095 GAGGGGCCTCGGCAGGGTGGGGG + Intronic
968123449 3:196142192-196142214 GAGGGGCCCAGACCTGCTGCAGG - Intergenic
968123458 3:196142218-196142240 GAGGGGCCCAGACCCGCTGCAGG - Intergenic
968123467 3:196142244-196142266 GAGGGGCCCAGACCCGCTGCAGG - Intergenic
968469541 4:773056-773078 GAGGGGCCCTGGCAGACTGGGGG - Intergenic
968476882 4:814823-814845 GAGGGGCCCCGGCCATGGGTCGG + Intronic
968960254 4:3739751-3739773 GAGGGGCCTCTGCCAGCTGCAGG - Intergenic
969700252 4:8764079-8764101 GAGGGTCCCCGGCCGCCCCTTGG + Intergenic
973293379 4:48490874-48490896 GAGGGGCCCGGGCCCGCGGCGGG + Exonic
973996919 4:56467768-56467790 GGCGGGCCCAGGCCGGCTGGAGG + Intronic
975241751 4:72067334-72067356 GAGGAGCCCAGGGTGGCTGTGGG - Intronic
976862411 4:89681383-89681405 GTGGGCCCCCGGTCTGCTGTGGG - Intergenic
977177499 4:93834843-93834865 GAGGGGCCCCGGCCGAGTGCGGG - Intergenic
982200627 4:152956895-152956917 AAGGGGCTCCTGCCGGCTCTGGG - Intronic
985695111 5:1335741-1335763 GTGAGGCCCCGGCAGGCTGCAGG - Intronic
989812658 5:45696173-45696195 TAGGGGCCCGAGCCGGCTGCCGG + Intergenic
991973426 5:72162938-72162960 GAGGAGCCTCGGCTGGGTGTGGG + Intronic
992067332 5:73120264-73120286 GAGATGCCCCCGCCGGCTGGCGG - Intergenic
1000021180 5:157320764-157320786 AAGGTGCCCCGGCGTGCTGTGGG + Exonic
1002190158 5:177473660-177473682 GAGGGGAGCCGGCCGGCGGGGGG + Intronic
1002194503 5:177494844-177494866 GAGGGGCAAGGGCTGGCTGTGGG - Intronic
1003339218 6:5203750-5203772 GAGGGGCCCTGCCCAGCTGCAGG - Intronic
1006639179 6:35480266-35480288 GAGGGGCCCAGGAGGGCTGAAGG + Intronic
1008511175 6:52277111-52277133 GAGGAGCCCCGGCCAGTGGTGGG + Exonic
1010428192 6:75749218-75749240 GCGGGGCGCCGGCCGGCGGGCGG + Intronic
1018940460 6:168306207-168306229 GAGGGGCCCAGGACGTCTGCGGG + Intronic
1019308437 7:347312-347334 GCAGGGCCTCGGCGGGCTGTAGG + Intergenic
1019359862 7:599136-599158 GTGTGGCCCTGGCCGTCTGTGGG - Intronic
1020281422 7:6652167-6652189 GAGGTGCCCCGTCCGACTGAAGG + Intronic
1023418338 7:39951567-39951589 GAGGGACCGCCGCCGCCTGTAGG - Exonic
1023972111 7:44999645-44999667 GAGGGGACGCGGCCGGCAGATGG - Intronic
1024632243 7:51259468-51259490 GATGGGCCCCACCTGGCTGTCGG - Intronic
1025020837 7:55477898-55477920 GAGGGACCCCGGCCAGGTGGAGG + Intronic
1029437749 7:100572486-100572508 GAGGGGCCCCGGGAGGGTGATGG + Exonic
1029531493 7:101128313-101128335 GAGGGGAGCTGGCCAGCTGTGGG - Intronic
1036645761 8:10610891-10610913 GAGAGGCCCCAGCAGGCTGCAGG - Exonic
1039475588 8:37837826-37837848 GAGGGGCCCGGGGAGGCTGGGGG + Exonic
1043138481 8:76558111-76558133 GAGGGGCCCAGGGCATCTGTGGG + Intergenic
1043401909 8:79892071-79892093 GAGGCGCCCCGGCAGGAGGTCGG - Intergenic
1045976118 8:108131958-108131980 CAGGGGCCGCTGCGGGCTGTGGG + Intergenic
1049075881 8:140395929-140395951 AAGGGTCAGCGGCCGGCTGTGGG - Intronic
1049218579 8:141418658-141418680 GAGGGGCCACGGCTGCCAGTGGG + Intronic
1049765921 8:144355170-144355192 GTGGGGCCCCGCCCAGCTGTGGG - Intronic
1049798823 8:144508565-144508587 GAGGGGCCAGGGCTGGCCGTGGG + Intergenic
1056992304 9:91423605-91423627 CCGGGCCCCCGGCCGGCGGTGGG + Intronic
1058619119 9:106864209-106864231 GGGGGGCACCGGCCGGGTGGGGG + Intronic
1059176673 9:112174983-112175005 GTGGGGCCCGCGCCGGCCGTTGG - Intronic
1060051566 9:120382204-120382226 GAGGCGCCCAGGCTGGCTGCAGG + Intergenic
1061006236 9:127929823-127929845 GAGAAGCCCCCGCCGGCTGGAGG + Exonic
1061587245 9:131577068-131577090 GGGGGGCCCGGGCGGGTTGTGGG - Exonic
1061727756 9:132590578-132590600 GCGGGGCCTCGGTCGGCTGCGGG + Intergenic
1062147245 9:134996502-134996524 GAGGGGCCCAGGCAGTCAGTGGG + Intergenic
1203360685 Un_KI270442v1:217715-217737 GCGCGGCCCCGGCTGGCTGAGGG + Intergenic
1189308673 X:40005708-40005730 GAGGGGGCCGGGCCGGAGGTGGG - Intergenic
1189355417 X:40306685-40306707 CAGGGGCCCCCTCCAGCTGTTGG + Intergenic
1192342518 X:70276196-70276218 GAGGGGCCCCTGAGGGCTGCTGG - Exonic
1192428420 X:71096747-71096769 GGGGGCCCCCGGCCGGCTCTGGG - Exonic
1195063584 X:101219555-101219577 GAGGGGCCCCTGCCAGCTGCTGG + Intergenic
1195379048 X:104254283-104254305 GAGGGGCCACAGCCGGCGGAGGG - Exonic
1199772501 X:150983753-150983775 GAGGGGCGGCTGCGGGCTGTGGG + Intronic
1200100612 X:153687841-153687863 GAGGGGGGCCGGCCGGCCGTGGG + Intronic