ID: 912672110

View in Genome Browser
Species Human (GRCh38)
Location 1:111639732-111639754
Sequence ACAGTCCTGTCTGAAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912672110_912672115 24 Left 912672110 1:111639732-111639754 CCAGGCATTTCAGACAGGACTGT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 912672115 1:111639779-111639801 GTTGAATTGTCACCACAGCCAGG No data
912672110_912672111 0 Left 912672110 1:111639732-111639754 CCAGGCATTTCAGACAGGACTGT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 912672111 1:111639755-111639777 TGTCTGACACTAGCCTCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912672110 Original CRISPR ACAGTCCTGTCTGAAATGCC TGG (reversed) Intronic
903546119 1:24124348-24124370 ACTGTCCTGTCTAAAATGGAGGG + Intronic
903609120 1:24597134-24597156 ACAGTCCTGAGGGAAATGCAGGG + Intronic
904637304 1:31892492-31892514 ACAGTCGTGTGTCAAATGCCTGG - Intergenic
908444856 1:64190756-64190778 AGAGGCTTGTCAGAAATGCCTGG + Intergenic
912672110 1:111639732-111639754 ACAGTCCTGTCTGAAATGCCTGG - Intronic
915854096 1:159362681-159362703 ACAGTCTGGTCTCAAATTCCTGG - Intergenic
919525784 1:198648488-198648510 ACAGTCATGTCTTAAATTCCAGG - Intronic
919898962 1:202029658-202029680 CCACTCCTGCCTGAAATGCTAGG - Intergenic
921707855 1:218345092-218345114 ACAGACCTGTCCAAAATGACTGG + Intergenic
922001713 1:221485369-221485391 ACAGTGCTGCTTGAAAAGCCAGG + Intergenic
1063371815 10:5527104-5527126 ACAGACCTGACTGAAATCCCAGG - Intergenic
1063405394 10:5789494-5789516 ACAGTACAGCCTCAAATGCCTGG + Intronic
1064398528 10:15001255-15001277 AATGTCCTGTCTGGAATGCAGGG + Intergenic
1066185604 10:33007534-33007556 TCAGCCCTGTCTGGATTGCCAGG + Intergenic
1073634904 10:105187650-105187672 TCAGTTCTCTCTGAAAGGCCTGG - Intronic
1074490757 10:113937515-113937537 ACATTGCTGGCTGAAATGTCAGG - Intergenic
1075352040 10:121732915-121732937 ACAGTCCTGCCTCAAGTGCTGGG + Intergenic
1076138859 10:128064085-128064107 ACAGTCCTCGCTACAATGCCTGG - Intronic
1077577147 11:3392946-3392968 AATGTCCTGTCTGGAATGCAGGG + Intergenic
1079039440 11:17048532-17048554 AATGTCCTGTCTGGAATGCAGGG - Intergenic
1081615156 11:44586451-44586473 CCAGACTTGTCTCAAATGCCTGG - Intronic
1082874434 11:57973582-57973604 ACAGTCCTGTCTGTCATTCTTGG - Intergenic
1082980893 11:59119468-59119490 ACACTCCTGCCTGAAAATCCTGG - Intronic
1083545683 11:63547367-63547389 AGATTCCTGGCTGAAATACCAGG + Intergenic
1084229083 11:67737729-67737751 AATGTCCTGTCTGGAATGCAGGG + Intergenic
1084326689 11:68404407-68404429 GCAGTCCTGGGTGAGATGCCCGG + Intronic
1084846196 11:71901967-71901989 AATGTCCTGTCTGGAATGCAGGG - Intronic
1085121464 11:73970096-73970118 ACAGTCATGTCAGCAATGCCTGG - Exonic
1086442725 11:86845307-86845329 AATGTCCTGTCTGGAATGCAGGG + Intronic
1086870877 11:92035079-92035101 ACAGAACTTTCTGAAATGCTAGG - Intergenic
1089269797 11:117294170-117294192 ACTGTCCTGTTTGCATTGCCAGG - Intronic
1090582416 11:128174690-128174712 AGATTCCTTTCTGAACTGCCTGG + Intergenic
1091295754 11:134472981-134473003 AGAGTCCTGTCTGAGAGCCCAGG + Intergenic
1092433747 12:8429800-8429822 AATGTCCTGTCTGGAATGCAGGG + Intergenic
1094404325 12:30098820-30098842 ACATTCCTGATTCAAATGCCTGG + Intergenic
1095429884 12:42121701-42121723 ACAATCCTTGCTGAAATACCTGG - Intronic
1096507740 12:52106117-52106139 AATGTCCTGTCTGGAATGCAGGG - Intergenic
1099172516 12:79381658-79381680 ATAGTCCTGGATGAAATTCCAGG + Intronic
1101168091 12:102060352-102060374 CCAGTCTTGTCTCAAATTCCCGG + Intronic
1102015655 12:109646234-109646256 ACAGTCTTGGGAGAAATGCCTGG + Intergenic
1102834920 12:116047138-116047160 TCAGTCTGGTCTCAAATGCCTGG - Intronic
1104053564 12:125212384-125212406 ACAGTCTGGTCTCAAATTCCTGG + Intronic
1104608995 12:130212883-130212905 ACAGACCTGTGTTCAATGCCTGG + Intergenic
1105576731 13:21660262-21660284 ATATTCCTGTCTGAAAGGCATGG - Intergenic
1106118400 13:26837245-26837267 GCAGCACTGTCTGAACTGCCAGG - Intergenic
1106312816 13:28568589-28568611 AGAGGCCTGTATGACATGCCCGG + Intergenic
1107545882 13:41433408-41433430 AATGTCCTGTCTGGAATGCAAGG + Intergenic
1107731132 13:43350334-43350356 ACAGTCATATCTGAAAGTCCAGG + Intronic
1109840221 13:67909788-67909810 AATGTCCTGTCTGGAATGCAGGG - Intergenic
1111611868 13:90615966-90615988 AGAGGCTTGTCAGAAATGCCTGG - Intergenic
1111909434 13:94293886-94293908 ACAGTCCTCCCTTAAATGGCTGG - Intronic
1111978493 13:94992825-94992847 GCAGAACTGACTGAAATGCCAGG + Intergenic
1114641948 14:24229511-24229533 AAAGTACTGTTTGAAAGGCCAGG - Intronic
1114791355 14:25662020-25662042 AGAGTCCTGTATGCAATGCCAGG - Intergenic
1115146957 14:30237274-30237296 ACAGTACTGTCATATATGCCCGG - Intergenic
1118018876 14:61690269-61690291 TCAGTGCTCTCTGAGATGCCTGG + Intergenic
1118776030 14:68974570-68974592 ACACACGTGGCTGAAATGCCAGG + Intronic
1119174911 14:72561915-72561937 AGAGTCCTGTTTGGAATGCAGGG - Intronic
1119528212 14:75340059-75340081 ACATTCCTGCCAGAAATTCCAGG - Intergenic
1120356972 14:83446492-83446514 CTAGTCTTGTCTCAAATGCCTGG + Intergenic
1121113448 14:91328023-91328045 ACAGTCCTGCCTGAGGTTCCTGG - Intronic
1121233761 14:92377561-92377583 ACAGCCGTGGCTGCAATGCCAGG + Intronic
1123691851 15:22844677-22844699 TCACTGCTGTCTCAAATGCCTGG - Intronic
1127695433 15:61442194-61442216 ATAGCACTGTCTGAATTGCCAGG - Intergenic
1128130073 15:65221189-65221211 TCACTGCTGTCTGAAATTCCTGG + Intergenic
1128320058 15:66687070-66687092 ACAGTCCTTACAGAAATGACAGG + Intergenic
1129512732 15:76136945-76136967 ACTGCCCTGGCTGAGATGCCCGG + Intronic
1129904474 15:79176521-79176543 TCATTACTGTCTGCAATGCCTGG - Intergenic
1130161246 15:81402670-81402692 AAAGTCATGACTGAAATGCATGG + Intergenic
1132901576 16:2257901-2257923 ACAGTGCTGTCTGGGCTGCCAGG - Intronic
1134436634 16:14264903-14264925 ACAGTCCTTTCAGAATTCCCAGG + Exonic
1135854493 16:25994425-25994447 ACAGTACTGTATGAAATGGTAGG - Intronic
1136593854 16:31233396-31233418 CCAGTCTGGTCTCAAATGCCTGG + Intergenic
1137838120 16:51613612-51613634 ACAGTCCTTTCAAAATTGCCTGG - Intergenic
1138524234 16:57592736-57592758 ACAGACCTCTCTGGAGTGCCTGG + Intergenic
1139489865 16:67280315-67280337 TCAGTCCTGTCAGAAGGGCCAGG + Exonic
1143220094 17:5254583-5254605 CCACTCCTTTCTGAAATGCTCGG - Intergenic
1144667526 17:17112161-17112183 ACATGCCTGTGTGAAAGGCCTGG + Intronic
1146005219 17:29156442-29156464 CCAGTCCTGTGAGAGATGCCAGG + Intronic
1146166276 17:30591861-30591883 ACAGGCTTGTCTGAAACTCCTGG - Intergenic
1149500704 17:57150190-57150212 ACAGACCTGGCAGAAATGACTGG - Intergenic
1150296783 17:64014262-64014284 CCAGGCCTGTCTCAAATTCCTGG - Intronic
1152136584 17:78507414-78507436 ACAGTCATTTCTGAAGTGCGTGG + Intronic
1153186572 18:2492857-2492879 ACAGTTCTGTCTAAAATCTCTGG - Intergenic
1153504212 18:5779620-5779642 TCAGCCCTGTCTGAAACTCCAGG - Intergenic
1153715994 18:7848560-7848582 ACAGTCTGGTCTCAAATTCCTGG - Intronic
1154286221 18:13059343-13059365 ACAGTCTTCTTTAAAATGCCAGG - Intronic
1155301711 18:24435177-24435199 CCAGACTTGTCTGAAATTCCTGG + Intronic
1155438787 18:25840241-25840263 AGTGTCCTATCTGAAATGCTTGG - Intergenic
1157594396 18:48855195-48855217 ACAGTCCTGTTCCAGATGCCAGG - Intronic
1159715949 18:71823552-71823574 ACACTCTTTTGTGAAATGCCAGG + Intergenic
1161299993 19:3537916-3537938 CCAGCCCTGGCTGAAATGCCAGG - Intronic
1163511994 19:17741033-17741055 TCAGGCCTGTCTGGAGTGCCTGG - Intergenic
1165488050 19:36107312-36107334 GCAGCCCTGACTGAAGTGCCTGG + Intergenic
1166009100 19:39927895-39927917 ACATTCCTGGCTGAGGTGCCGGG + Exonic
1167920406 19:52778770-52778792 TCTTTCCTTTCTGAAATGCCAGG - Intronic
1167921807 19:52788280-52788302 TCTTTCCTTTCTGAAATGCCAGG - Intronic
1167932051 19:52873936-52873958 TCTTTCCTTTCTGAAATGCCAGG - Intronic
1167944971 19:52980835-52980857 TCTTTCCTTTCTGAAATGCCAGG - Intergenic
1168042780 19:53771388-53771410 AATGTCCTGTCTGGAATGCAGGG + Intergenic
925108200 2:1310775-1310797 ACAGTTCTGTCTGAAATGATAGG - Intronic
927120228 2:19953039-19953061 ACAGTCATGACAGAAATGCTAGG - Intronic
927699462 2:25258758-25258780 CCATTCCTGTCTGAAAAACCTGG - Intronic
927844129 2:26462619-26462641 GCAGCCCTGTCTGCAATCCCAGG - Intronic
928329815 2:30349051-30349073 ACAGTACTGTGTGGAATGACTGG - Intergenic
929138943 2:38650567-38650589 TAAGTCCTGTCTGCAAGGCCAGG - Intergenic
932833905 2:75017044-75017066 ACAGTCTGGTCTCAAATTCCGGG + Intergenic
937086059 2:119172616-119172638 CCAGTCCTGTCTCAAACTCCTGG - Intergenic
940947292 2:159632190-159632212 ACAATCCTGTATGAAATCCAAGG + Intergenic
942595182 2:177585606-177585628 CCAGTAGTTTCTGAAATGCCAGG + Intergenic
946657341 2:221962491-221962513 ATACTCCTTTCTGAAATTCCAGG - Intergenic
947359454 2:229332866-229332888 CCAGGCTTGTCTGAAATTCCTGG - Intergenic
948124560 2:235555330-235555352 CCAGTCCAGTCTGCAAAGCCTGG + Intronic
948908468 2:240991258-240991280 ACTGTCCTGTCTGGAAGGCCTGG - Intronic
948947661 2:241229308-241229330 AGAGTGCTGACTGACATGCCGGG + Exonic
1168910185 20:1441033-1441055 GCAGTTCTCTCTGAAATGCTGGG + Intergenic
1174871452 20:54186379-54186401 CCAGTCCTGCCTGAAGTCCCAGG + Intergenic
1177523788 21:22266633-22266655 ATATTTCTGTCTGAAATACCAGG - Intergenic
1178296012 21:31411023-31411045 ACAGTCCTGTCCTCAATGTCAGG - Intronic
1178411441 21:32366707-32366729 ACTCTCTGGTCTGAAATGCCCGG + Exonic
1181154080 22:20907140-20907162 ACAGTGCTGTGGGATATGCCCGG + Intergenic
1182441020 22:30364055-30364077 GCAGTCCTCTCTGAAAGGCTTGG - Intronic
1182744634 22:32596129-32596151 GCAGGCCTGTCTTACATGCCTGG - Intronic
1183011512 22:34950618-34950640 AAAGTCCTGTCTGGAAAGTCTGG - Intergenic
949562574 3:5215979-5216001 AAAGTCCAGTCTGAAATGAAAGG + Exonic
951105466 3:18736968-18736990 ACAGTTGTGACTGAACTGCCAGG + Intergenic
952563621 3:34627721-34627743 TCAGTTCTCTCTGAGATGCCCGG - Intergenic
953468541 3:43146735-43146757 TCACTCTTGTCTGAGATGCCTGG - Intergenic
956679088 3:71761243-71761265 ACAGGCTTGTCTTAAATTCCTGG + Intergenic
957042832 3:75349954-75349976 AATGTCCTGTCTGGAATGCAGGG + Intergenic
957045674 3:75372557-75372579 AATGTCCTGTCTGGAATGCAGGG + Intergenic
958634288 3:96723141-96723163 ACAGTCTTATAGGAAATGCCTGG + Intergenic
959633764 3:108538018-108538040 ACTGTCATTTCTGAAAGGCCTGG + Intergenic
961276711 3:125733070-125733092 AATGTCCTGTCTGGAATGCAGGG - Intergenic
963422108 3:145073476-145073498 TCAGTCCTGACTGGAATGGCTGG + Intergenic
964479431 3:157127176-157127198 ACTTTCCTGGATGAAATGCCAGG - Intergenic
966314551 3:178631261-178631283 TCAGTACTTTCTGAAATTCCTGG + Intronic
966448130 3:180026683-180026705 ACAGTCCTGTCTCTAATGGCAGG + Intronic
967950123 3:194834269-194834291 ACATTCCTGTATGATAAGCCTGG + Intergenic
968277942 3:197455188-197455210 ACTCTCCTGTCAGAAATCCCTGG - Intergenic
968989946 4:3903714-3903736 AATGTCCTGTCTGGAATGCAGGG + Intergenic
969026392 4:4176442-4176464 AATGTCCTGTCTGGAATGCAGGG + Intergenic
969825378 4:9753648-9753670 AATGTCCTGTCTGGAATGCAGGG - Intergenic
970644468 4:18104395-18104417 ACAGTGCTTTCTGAAATGTTTGG + Intergenic
973263777 4:48190163-48190185 TCAATACTGTCTGAAATGCCAGG + Intronic
975270154 4:72421846-72421868 ACAGTCCTGTCTAAAATCTCAGG - Intronic
975601424 4:76104024-76104046 ACAGTATTCTCTTAAATGCCTGG - Intronic
976470134 4:85418663-85418685 GAAGTCCAGTCTGAAATGCAGGG - Intergenic
978770284 4:112449370-112449392 ACAGTGTTGCCTGAAATGCATGG - Intergenic
979421363 4:120509228-120509250 ACAGTGGTGTCTGGAATGCCAGG + Intergenic
979560964 4:122101844-122101866 ACATTTCTGCCTGTAATGCCAGG - Intergenic
979930863 4:126628536-126628558 ACAGTCCTATGTGAGATACCTGG - Intergenic
981285680 4:143016474-143016496 CCAGGCTTGTCTGAAATTCCTGG - Intergenic
981916206 4:150035930-150035952 ACAGTTTTGTCAGAAATGCTCGG - Intergenic
982717338 4:158822706-158822728 CCAGTCTTGTCTGGAATTCCTGG + Intronic
982815371 4:159877669-159877691 TCAGTCCAGTCTGAACTTCCTGG + Intergenic
986834221 5:11616814-11616836 CCAGTCTTGTCTCAAATTCCTGG + Intronic
987791625 5:22575931-22575953 ACAGGCTGGTCTGAAATTCCTGG + Intronic
987874442 5:23662111-23662133 AGAGTCCTGTCTGTAATGTAGGG + Intergenic
993216691 5:85033649-85033671 ACAGTCCAGTCTTAAAACCCAGG + Intergenic
995717260 5:115092475-115092497 ACATTGCTGGCTGGAATGCCTGG - Intergenic
997662085 5:135597054-135597076 AGAGCCCTGTCTGATATGCTAGG - Intergenic
998565366 5:143211768-143211790 ACAGTCTGGTCTTAAATTCCTGG + Intronic
998934162 5:147216485-147216507 CCAGTTGTGTCTGGAATGCCAGG + Intergenic
999025518 5:148226798-148226820 TCAGTCCTGTGTGAAATCCAAGG - Intergenic
1000012340 5:157244523-157244545 ACAGTTCTCACTGAAATGACTGG + Intronic
1001775685 5:174327658-174327680 ACAGTCCTGTCCGAGGAGCCTGG + Intergenic
1002935997 6:1672964-1672986 CCAATCCTCGCTGAAATGCCCGG - Intronic
1003220208 6:4154568-4154590 CCTGTGCTGTCTGATATGCCTGG + Intergenic
1003305040 6:4919414-4919436 ATAACCCTGTCTGAAATGCTTGG + Intronic
1009970750 6:70623269-70623291 GCAGCTCTGACTGAAATGCCTGG - Intergenic
1010086491 6:71924582-71924604 CCAGTCCGGTCTCAAATTCCTGG - Intronic
1011539353 6:88414270-88414292 CCATTGCTGTCTCAAATGCCTGG + Intergenic
1014923627 6:127243394-127243416 ACAGGCCTTACTGAAATACCTGG - Intergenic
1017979822 6:159391052-159391074 CCAGTCCTGTCTGATGTGGCTGG - Intergenic
1019605185 7:1906578-1906600 ACAGAGCTGTTTGAGATGCCTGG + Intronic
1019923294 7:4176376-4176398 ACAGGCCGGTCTTGAATGCCTGG + Intronic
1021144233 7:17065779-17065801 CCACTCCTGGCTCAAATGCCTGG - Intergenic
1021679668 7:23117358-23117380 ACAGTTCTCTCAGAAAGGCCTGG - Intronic
1024169020 7:46765076-46765098 ACAGTCCTCTCCTAAATGTCTGG - Intergenic
1026192513 7:68142496-68142518 CCAGGCTTGTCTCAAATGCCTGG + Intergenic
1027235582 7:76295713-76295735 ACAGCCCTCTCTGAACTGTCTGG + Intergenic
1027499069 7:78925315-78925337 TCAGCACTGTCTGAAAAGCCAGG + Intronic
1027959325 7:84924113-84924135 AAAGTCCTGTATGAAAGGGCGGG - Intergenic
1027968988 7:85052526-85052548 ACAACGCTGCCTGAAATGCCTGG + Intronic
1032578451 7:133081320-133081342 ACAGTCTTTTCTGACCTGCCTGG - Intronic
1036818705 8:11921956-11921978 AATGTCCTGTCTGGAATGCAGGG + Intergenic
1037715339 8:21392675-21392697 TCAGGCCTGTCTCAAATCCCTGG - Intergenic
1041670946 8:60491461-60491483 ACACTGCTGTCAGAAAGGCCAGG + Intergenic
1041681719 8:60600280-60600302 CCAGTCCAGTCTCAAATTCCTGG - Intronic
1043991377 8:86759861-86759883 ACAGTCCAGTATTAAAGGCCAGG + Intergenic
1044486116 8:92756573-92756595 AAAATCTTGTCTGAAATTCCTGG + Intergenic
1044725232 8:95189566-95189588 AGGGTCCTGTGTGGAATGCCTGG - Intergenic
1045571586 8:103372963-103372985 AAAGTGCTGTGTGAAATGGCGGG - Intronic
1045911089 8:107410547-107410569 ACTGTCTTGTCTGAAAAGCTAGG + Intronic
1046562080 8:115850672-115850694 ACAGCCCTGTGAGAAATGCATGG + Intergenic
1048232506 8:132657945-132657967 ACAGTCCTTTCTAAGATGACAGG + Intronic
1050641384 9:7671174-7671196 CCAGGCCTGGCTGAATTGCCAGG + Intergenic
1052406716 9:28070476-28070498 ACAGTCCTGCCTTAAATCCCAGG + Intronic
1053104042 9:35395337-35395359 ACAGTGCTGCCTGCAGTGCCAGG + Intronic
1056864186 9:90214800-90214822 AATGTCCTGTCTGGAATGCAGGG - Intergenic
1062189979 9:135242977-135242999 ACAGTGCTGTCTGGGCTGCCAGG - Intergenic
1203655830 Un_KI270752v1:23723-23745 ACAGGCCAGTGTGAAAGGCCTGG - Intergenic
1185454390 X:301218-301240 ACAGTCTGGTCTCAAATTCCTGG + Exonic
1188892349 X:35626193-35626215 ACAGTCCTGTCAGAACGGGCAGG - Intergenic
1189910534 X:45806258-45806280 ACAGACAAGTCTGAAGTGCCTGG - Intergenic
1191189763 X:57654377-57654399 AAAGTCCTATCTGAGATTCCAGG + Intergenic
1192043370 X:67646146-67646168 ATATTTCTGTCTGAGATGCCAGG - Intronic
1194042196 X:88955399-88955421 CCAGGCTGGTCTGAAATGCCTGG + Intergenic
1198261941 X:134972871-134972893 GCAGGCATGTCTTAAATGCCTGG - Intergenic