ID: 912672115

View in Genome Browser
Species Human (GRCh38)
Location 1:111639779-111639801
Sequence GTTGAATTGTCACCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912672109_912672115 25 Left 912672109 1:111639731-111639753 CCCAGGCATTTCAGACAGGACTG 0: 1
1: 0
2: 0
3: 35
4: 506
Right 912672115 1:111639779-111639801 GTTGAATTGTCACCACAGCCAGG No data
912672110_912672115 24 Left 912672110 1:111639732-111639754 CCAGGCATTTCAGACAGGACTGT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 912672115 1:111639779-111639801 GTTGAATTGTCACCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912672115 Original CRISPR GTTGAATTGTCACCACAGCC AGG Intronic
No off target data available for this crispr