ID: 912677116

View in Genome Browser
Species Human (GRCh38)
Location 1:111693231-111693253
Sequence TGCCATAACCATAATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912677116 Original CRISPR TGCCATAACCATAATGGGGT GGG Intronic
900165199 1:1241725-1241747 TGCCAGAGCCAAAATGGGGTGGG + Intergenic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
907692892 1:56688207-56688229 ACCCCTAACCACAATGGGGTAGG - Intronic
912504386 1:110146087-110146109 AGTCATAACCATAAAGGGTTTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913120806 1:115738887-115738909 TGCCAAAAGCAGGATGGGGTGGG - Intronic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
919983472 1:202657173-202657195 TGTCATGACCATGATGAGGTTGG - Intronic
920826102 1:209425542-209425564 GTCCATGACCATAATGGGGATGG - Intergenic
1074832308 10:117257514-117257536 TGATAAAACCATAATTGGGTAGG + Intronic
1081591760 11:44427960-44427982 TGCCATCGCCATATTGGGGAAGG - Intergenic
1084470741 11:69357606-69357628 TGCCACATCCATGGTGGGGTGGG + Intronic
1084646514 11:70462002-70462024 TGCCAGGAACAAAATGGGGTGGG - Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1086790128 11:91026747-91026769 TCTCTTAACCATAATAGGGTAGG - Intergenic
1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG + Intergenic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG + Intergenic
1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1114462977 14:22900007-22900029 TGCCTTAATAATAAGGGGGTGGG - Intergenic
1116946092 14:50836631-50836653 TCCTTTAACCATAATGGAGTTGG - Intergenic
1117837755 14:59825339-59825361 TGCCTAAACCATATTGGGGCTGG - Intronic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG + Intronic
1124818212 15:33018100-33018122 TACCATCACCTTAAGGGGGTAGG - Intronic
1135477594 16:22790453-22790475 TAACATAACCATTATGGGTTGGG + Intergenic
1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG + Intronic
1144760314 17:17703476-17703498 TCCCATAACCTTTTTGGGGTGGG + Intronic
1147773645 17:42885061-42885083 TCCCATCACCATGATGTGGTGGG - Intergenic
1156578589 18:38349114-38349136 TGCCCTAACTATAAGTGGGTGGG - Intergenic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1167822771 19:51944190-51944212 TGCCATAAACATAATGCATTTGG + Exonic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
938066292 2:128283676-128283698 TGCCATCCCTATAATGGGGGAGG - Intronic
940836775 2:158530683-158530705 TGCCACAACCAACATGGGGCAGG - Intronic
945316055 2:208371802-208371824 TGACATACTCATAATGGGGTAGG + Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
950892364 3:16415278-16415300 TGCCAGAACTATCATGGGGAAGG + Intronic
956654210 3:71533601-71533623 TCACAGAACAATAATGGGGTTGG - Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG + Intronic
970113778 4:12669846-12669868 TGCCATAACCACAGTGCAGTTGG + Intergenic
970270901 4:14346300-14346322 TGGCATAGCCCTAATGGTGTAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976517010 4:85980500-85980522 TGCAGTAACCATACTGGTGTTGG - Intronic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
991173336 5:63654754-63654776 AGCCACAACCCTATTGGGGTAGG - Intergenic
994477528 5:100290136-100290158 TGGCATAATCATAATGGTGGTGG - Intergenic
994583381 5:101675956-101675978 TGCTATAAACAAACTGGGGTGGG - Intergenic
996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG + Intergenic
997430093 5:133831652-133831674 TGCCAGAACCATAAGGAAGTAGG + Intergenic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1007222297 6:40288511-40288533 TGCCATAAGCAAATTGTGGTTGG + Intergenic
1008147849 6:47913119-47913141 TGACACAACCAATATGGGGTAGG - Intronic
1017994903 6:159523500-159523522 TGCCATGACCTTAAGGGGGTGGG - Intergenic
1019788487 7:2994865-2994887 TGCCATGAACATAAGGGCGTGGG - Intronic
1021503413 7:21354560-21354582 TGTCATAACCTGAATGGGTTTGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028563521 7:92202604-92202626 TGCCAGAAAGATAATGGGTTAGG + Intronic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1043826342 8:84933822-84933844 TGCTATATCCCTAATGGGGAGGG - Intergenic
1044624231 8:94220518-94220540 TGCCAGAATCAAAATGGAGTTGG + Intergenic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1047180094 8:122579211-122579233 TGCCAGAACCAAAGTGCGGTAGG - Intergenic
1047957527 8:129986855-129986877 TGCCATTACCAGAAGGGGCTTGG - Intronic
1048952211 8:139505477-139505499 TCCTATAGCCATACTGGGGTGGG + Intergenic
1050556389 9:6792976-6792998 TGCCCTAACCATCATGGAGGTGG + Exonic
1055846384 9:80568594-80568616 TACCATAAACATAATGTGATCGG - Intergenic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG + Intronic
1186630521 X:11343922-11343944 TGTCATAACCATACTGGGATAGG - Intronic
1187247111 X:17562570-17562592 TGCTATAATCACAAAGGGGTGGG + Intronic
1189427727 X:40916485-40916507 TGCCAAAAGGCTAATGGGGTAGG - Intergenic
1190904007 X:54708194-54708216 TTACAAAACCACAATGGGGTTGG + Intergenic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG + Intergenic