ID: 912679491

View in Genome Browser
Species Human (GRCh38)
Location 1:111720138-111720160
Sequence CAGACTCAATGTCCCTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912679482_912679491 15 Left 912679482 1:111720100-111720122 CCTCCCTCCATAATCACAATGAT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679484_912679491 12 Left 912679484 1:111720103-111720125 CCCTCCATAATCACAATGATGGG 0: 1
1: 0
2: 1
3: 10
4: 117
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679480_912679491 17 Left 912679480 1:111720098-111720120 CCCCTCCCTCCATAATCACAATG 0: 1
1: 0
2: 1
3: 31
4: 256
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679477_912679491 26 Left 912679477 1:111720089-111720111 CCTGCCCTGCCCCTCCCTCCATA 0: 1
1: 1
2: 14
3: 138
4: 1322
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679476_912679491 27 Left 912679476 1:111720088-111720110 CCCTGCCCTGCCCCTCCCTCCAT No data
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679486_912679491 11 Left 912679486 1:111720104-111720126 CCTCCATAATCACAATGATGGGA 0: 1
1: 0
2: 1
3: 8
4: 122
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679479_912679491 21 Left 912679479 1:111720094-111720116 CCTGCCCCTCCCTCCATAATCAC No data
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679488_912679491 8 Left 912679488 1:111720107-111720129 CCATAATCACAATGATGGGAGGA 0: 1
1: 0
2: 1
3: 5
4: 134
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679481_912679491 16 Left 912679481 1:111720099-111720121 CCCTCCCTCCATAATCACAATGA No data
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data
912679478_912679491 22 Left 912679478 1:111720093-111720115 CCCTGCCCCTCCCTCCATAATCA 0: 1
1: 0
2: 3
3: 39
4: 427
Right 912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912679491 Original CRISPR CAGACTCAATGTCCCTAGTG GGG Intronic
No off target data available for this crispr