ID: 912679892

View in Genome Browser
Species Human (GRCh38)
Location 1:111722328-111722350
Sequence CAGGGTGGCCGGAGGGCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 0, 2: 9, 3: 105, 4: 942}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912679882_912679892 -4 Left 912679882 1:111722309-111722331 CCTTTAGGCCATTAGTTTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG 0: 1
1: 0
2: 9
3: 105
4: 942
912679881_912679892 4 Left 912679881 1:111722301-111722323 CCACAGCACCTTTAGGCCATTAG 0: 1
1: 0
2: 1
3: 7
4: 86
Right 912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG 0: 1
1: 0
2: 9
3: 105
4: 942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912679892 Original CRISPR CAGGGTGGCCGGAGGGCAGG AGG Exonic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900226263 1:1534924-1534946 CAGCTTGGGCGGAGGGGAGGGGG - Intergenic
900287204 1:1907426-1907448 CTGGGAGGCCTGAGGGCATGGGG + Intergenic
900457827 1:2785970-2785992 CAGGGTGGGCTGGAGGCAGGCGG + Exonic
900506507 1:3032124-3032146 CAGGGTGCCCGGGTGGCAGCAGG - Intergenic
900643154 1:3696883-3696905 GAGGGTGGCAGGGGGGCCGGAGG - Intronic
900644330 1:3702241-3702263 CAGGCAGGCCAGGGGGCAGGCGG + Intronic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900966010 1:5959133-5959155 CATGGTGTCCGGAGGGAGGGAGG - Intronic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
901217177 1:7561359-7561381 CAGAGAGGCCGGCGGGCAGCAGG + Intronic
901479063 1:9511638-9511660 CAGGGAGGGCGGAGGGAAAGCGG + Intergenic
901489336 1:9588830-9588852 CAGGCGGGCAGGCGGGCAGGAGG - Intergenic
901489339 1:9588838-9588860 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
901757102 1:11448084-11448106 CAGGGCGGCCTGAGGGCTGGGGG + Intergenic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902111808 1:14085436-14085458 CAGGGTTGCCAGTGGTCAGGGGG - Intergenic
902205535 1:14865633-14865655 CAGGATGGCTGGAGAGCAAGGGG - Intronic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
902609743 1:17589958-17589980 CAGGATGGCAGAGGGGCAGGGGG + Intronic
902799085 1:18818385-18818407 TAGGGTGGAGGGAGGGCTGGAGG + Intergenic
903172417 1:21562617-21562639 GATGGTGGCCGCAGGGCAGGTGG + Intronic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903553669 1:24177545-24177567 CAGGCTGGCTGGAAAGCAGGTGG - Intronic
903568578 1:24287037-24287059 GAGGGTGGGCGGAGGGCGGTGGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903859189 1:26354838-26354860 AGGGGTGCCTGGAGGGCAGGGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904449525 1:30601914-30601936 CATGGGGGCAGCAGGGCAGGTGG + Intergenic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904597529 1:31656286-31656308 CAGGAAGGCCAGTGGGCAGGGGG - Intronic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
905202453 1:36323546-36323568 CAGCGGGGCCGGAGGGGCGGCGG - Intronic
905282677 1:36859290-36859312 CAGGGTGGGCTGAGGACTGGAGG - Intronic
905395396 1:37663394-37663416 CATGGTGGCTGGTGGGCAAGCGG + Intergenic
905403092 1:37717117-37717139 TAGGGTGGCAGGAAGGCAGCTGG - Exonic
905449381 1:38046920-38046942 CAGGGTGGCGGGCGGGCGCGCGG - Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905647235 1:39633156-39633178 CAGGCGGGGCGGAGGGCGGGCGG - Intronic
906058260 1:42932259-42932281 CAGGGTGGGGGCAGGGCTGGTGG - Intronic
906158076 1:43625834-43625856 TGTGGTGGCTGGAGGGCAGGGGG - Intergenic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906514772 1:46432391-46432413 CAGGGTGGCAGGAGGGGCTGGGG + Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906543288 1:46604339-46604361 CAGGGCCGCCTGAGGGCAGGGGG + Intronic
906693721 1:47810361-47810383 ATGGGTGGCGGGGGGGCAGGGGG - Intronic
906778169 1:48548576-48548598 AAGGGAGGCCGCAGGCCAGGCGG - Intronic
906940431 1:50250969-50250991 GAGGGTGGCAGGTGGGCAGAAGG + Intergenic
907197313 1:52697515-52697537 AAGGGTGTCAGGAGGGCAGGAGG - Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908401408 1:63775044-63775066 CGGGAGGGCCGGAGGGCCGGGGG - Intronic
909475288 1:76074838-76074860 CTCGGTGGCAGGAGGGCCGGCGG + Exonic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909745742 1:79095185-79095207 CAGGGTGGCCAAAGGTCACGTGG + Intergenic
910245334 1:85132697-85132719 CAGGAGGGCAGGTGGGCAGGAGG - Intronic
910245337 1:85132705-85132727 CAGGAAGGCAGGAGGGCAGGTGG - Intronic
910679139 1:89844191-89844213 CAGGGTGGTGGGAGGGTAAGGGG + Intronic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912513598 1:110204451-110204473 CAGGTTTGCCCCAGGGCAGGTGG + Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
914319460 1:146545078-146545100 CAGGGTGGCGGGGGTGGAGGTGG + Intergenic
915345568 1:155195263-155195285 CGGGGAGGCCGGGGGGCCGGGGG - Intergenic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915461721 1:156074666-156074688 CTCGGTTGCCGGGGGGCAGGTGG - Exonic
915528104 1:156488434-156488456 CAGGGAGGATGCAGGGCAGGAGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916120662 1:161525488-161525510 CAGGGTGGCCTGGGTGCTGGAGG - Exonic
916130428 1:161607120-161607142 CAGGGTGGCCTGGGTGCTGGAGG - Intronic
916470665 1:165119284-165119306 CAGGGTGGCAGCCCGGCAGGGGG - Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
919623921 1:199892580-199892602 CAGGATTGCCGGAGCCCAGGAGG + Intergenic
920296536 1:204960731-204960753 TGGGGTGGCCCAAGGGCAGGTGG - Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920695704 1:208180017-208180039 CAGGGTGGGGGCGGGGCAGGAGG - Intronic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922740842 1:228013527-228013549 CAGCTGGGCCGGCGGGCAGGAGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922807422 1:228397595-228397617 CAGGGAGCCTGCAGGGCAGGTGG - Intronic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923401576 1:233619924-233619946 CGGGGGGGCGGGGGGGCAGGGGG + Intronic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
924561175 1:245156870-245156892 CAGGCCGCCCGGGGGGCAGGAGG + Intronic
924598270 1:245465758-245465780 TGGGGAGGCCTGAGGGCAGGAGG + Intronic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1064016842 10:11779442-11779464 AAGGGTGGCCCTGGGGCAGGAGG + Intergenic
1064515687 10:16145376-16145398 GAGGGTGGGTTGAGGGCAGGAGG - Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065020060 10:21496098-21496120 GAGGGAGGCAGGAAGGCAGGCGG - Intronic
1065681518 10:28238630-28238652 CAGGGTGTCCGGAGAGCGGTGGG - Exonic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1066086774 10:31979175-31979197 CAGGGTGGCGGCCGGGCAGAGGG + Intergenic
1066107358 10:32167563-32167585 CTGGTTGGCCTGGGGGCAGGAGG - Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1067034239 10:42900742-42900764 CAGGGTGGCGGCCGGGCAGAGGG - Intergenic
1067054446 10:43042810-43042832 CAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1067166740 10:43871271-43871293 AAGGCTGACCGGAGAGCAGGAGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067683067 10:48452218-48452240 GAGGGTGGCAGGAGGGAATGAGG - Intronic
1070145765 10:73772420-73772442 GAGGGAGGCCGGCGGGGAGGCGG + Exonic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070329072 10:75405204-75405226 TATTGAGGCCGGAGGGCAGGCGG + Intergenic
1070507556 10:77127631-77127653 CAGGAAGGCAGGAAGGCAGGAGG + Intronic
1070976288 10:80608525-80608547 CAGTGTAGCCCGAGTGCAGGGGG + Intronic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072349800 10:94545727-94545749 CAGCGGGGCGGGAGGGCGGGTGG + Intronic
1072451582 10:95543200-95543222 CAGGGTGCCATGAGGGCATGTGG - Intronic
1072591517 10:96832420-96832442 CGGGGCGGCCGGAGGGGCGGCGG - Intronic
1072615922 10:97048884-97048906 CAAGTAGGCCGGTGGGCAGGTGG + Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073084573 10:100879966-100879988 CAGGGTGGCTACATGGCAGGTGG - Intergenic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074764163 10:116688235-116688257 AAGGCTGGCTGGAGGGCTGGTGG - Intronic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075700587 10:124467187-124467209 CAGGCTGGCAGTAGGGCAGGAGG + Intronic
1075705381 10:124497311-124497333 CAGGGTCCACGGCGGGCAGGGGG - Intronic
1076393628 10:130122018-130122040 CAGGAGGGCAGGAGAGCAGGGGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076544953 10:131238947-131238969 CAGGGAGGCAGGAGAGCAGCAGG - Intronic
1076615437 10:131751526-131751548 CCGGGAGGCCAGAGGTCAGGTGG - Intergenic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1076908251 10:133373701-133373723 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908254 10:133373709-133373731 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908257 10:133373717-133373739 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908260 10:133373725-133373747 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908263 10:133373733-133373755 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077019250 11:410263-410285 CATGGTGGCCCCAGGGCCGGTGG - Intronic
1077026276 11:441444-441466 CAGAGTGGCCGGCGGGCTGTGGG - Intronic
1077044103 11:536886-536908 CGCGGTGGACGGACGGCAGGCGG - Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077316109 11:1920064-1920086 GGGAGTGGCCTGAGGGCAGGAGG + Intronic
1077358665 11:2130169-2130191 GAGGCTGGCCGGAGGGGAAGGGG - Intronic
1077378481 11:2216452-2216474 CAGGGTCTCCTGAGGTCAGGAGG + Intergenic
1077385979 11:2269695-2269717 CAGGGAGGAGGGAGGGCCGGGGG - Intronic
1077421808 11:2454214-2454236 AAGGGTGGCGGGGGGGGAGGTGG + Intronic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1078011261 11:7574782-7574804 CAGGTTGGCAGGAGGGAAAGGGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078122499 11:8523785-8523807 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
1080360911 11:31512778-31512800 GAGGGGGGGCGGAGGGCAGGGGG - Intronic
1081566458 11:44263969-44263991 CAGGCAGGCCGGAGAGCGGGAGG + Exonic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1081845569 11:46238267-46238289 GAGGGGGCCGGGAGGGCAGGAGG - Intergenic
1083034965 11:59628530-59628552 CAGGCAGGCGGGTGGGCAGGAGG - Intergenic
1083152206 11:60798848-60798870 AAGGGAGGCCAGAGGGCATGGGG - Intronic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083592564 11:63904174-63904196 TAGGGTGGGCTGAGGGCAGCAGG - Intronic
1083595483 11:63916778-63916800 CAGGGCGCCCCGAGGACAGGGGG - Exonic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083799555 11:65038651-65038673 CTGGGAGCCAGGAGGGCAGGAGG + Exonic
1084315624 11:68343728-68343750 CACTGAGGCCTGAGGGCAGGAGG - Intronic
1084353982 11:68624604-68624626 CAGGGTGTGAGGAGGGGAGGTGG - Intergenic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084413607 11:69017846-69017868 GTGGGTGGCTGCAGGGCAGGAGG + Intergenic
1084424415 11:69076811-69076833 CACGAGGGCAGGAGGGCAGGTGG - Intronic
1084424434 11:69076877-69076899 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424493 11:69077068-69077090 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424503 11:69077101-69077123 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084938289 11:72598959-72598981 TAGGGTGGCAGGAGGGCAACGGG + Intronic
1085520475 11:77136215-77136237 CACGGCGGCCAGAGGGCAGTAGG - Intronic
1088289299 11:108219179-108219201 GTGGGAGGCTGGAGGGCAGGAGG + Intronic
1088325232 11:108593874-108593896 GAGGGTGACCGGAGGGGACGAGG - Intergenic
1088522273 11:110712485-110712507 CAGGGCGCCCGGAGCGGAGGGGG - Intronic
1088910139 11:114184521-114184543 CAGGGAGGCCGAAGGGTACGGGG + Intronic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089278563 11:117356277-117356299 CCAGGTGGCCGGAGGGCCTGGGG + Intronic
1089634039 11:119801004-119801026 CAGGGGGCCGGGAGGGCTGGTGG - Intergenic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1089913182 11:122124443-122124465 CAGGGCGGTGGGGGGGCAGGGGG - Intergenic
1090252078 11:125258743-125258765 CAGGGCGGCAGCAGGGGAGGGGG - Intronic
1091527912 12:1323965-1323987 CAGGGAGGTGGGAGGGCAGGGGG - Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1092531389 12:9348530-9348552 TAGGAAGGCCGGAGGGCATGGGG + Intergenic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1093435393 12:19129917-19129939 CGCGGGGGCGGGAGGGCAGGAGG + Intronic
1094272258 12:28629910-28629932 CAGGCAGGCCGGCAGGCAGGCGG + Intergenic
1094502366 12:31032874-31032896 TAGGAAGGCCGGAGGGCATGGGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095413044 12:41945471-41945493 CATGGTGGCAGGAGGGATGGGGG + Intergenic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1095960888 12:47833597-47833619 CAGGCAGGCAGGTGGGCAGGGGG + Intergenic
1095975128 12:47935147-47935169 CACGGGGGCAGGAGGGCATGAGG + Intronic
1096182299 12:49557603-49557625 CAGGGTGCCATGAGGGGAGGAGG - Exonic
1096231992 12:49901942-49901964 CAGGGTGGAGGAAGGGCAAGAGG + Intronic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096708399 12:53437756-53437778 CGGGGTGGCGGCAGGGCAGAGGG - Intergenic
1096869177 12:54582869-54582891 AAGGGGGGCTGGAGGGCATGGGG - Intronic
1097054453 12:56241413-56241435 AAGGGTGGGCTGAGGGGAGGGGG - Exonic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1097889045 12:64759204-64759226 CTGGGCTGCAGGAGGGCAGGTGG + Exonic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1102190039 12:110980853-110980875 GAGGGAGGACGGAAGGCAGGTGG + Intergenic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102465999 12:113131175-113131197 CAGGGAGGCCTGAGGCCAGCAGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102587557 12:113933653-113933675 CAGGGGGACCCGCGGGCAGGGGG + Intronic
1103030179 12:117606521-117606543 CAGGGAGGCAGGAAGGAAGGAGG - Intronic
1103155422 12:118680576-118680598 CAGGGCGGCAGGCCGGCAGGGGG - Intergenic
1103350224 12:120278532-120278554 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
1103504590 12:121433320-121433342 CAGGCTGGCGGGCGGGCAGGCGG - Intronic
1103593656 12:122010012-122010034 CAGTCTGGCCGGTGGGCTGGGGG - Intergenic
1103659920 12:122506027-122506049 TCGGGAGGCCGGGGGGCAGGCGG - Intronic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1103779271 12:123388747-123388769 CGGGCTGGCGGGAGGGCGGGCGG + Intronic
1104597993 12:130132968-130132990 GAGGGAGGCAGGAGGGCTGGAGG + Intergenic
1104774614 12:131384059-131384081 CAGGGTGGTCCCAGTGCAGGCGG - Intergenic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104940543 12:132392543-132392565 CAGGGTGGCCGGAGGGTCCGGGG - Intergenic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1106111647 13:26783039-26783061 CAGGGTGGCAGGAAGCTAGGAGG - Intergenic
1106213058 13:27668739-27668761 GAGGTTGGCAGGGGGGCAGGGGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106928354 13:34636462-34636484 TAGGGTGGCCGCTGGGAAGGAGG - Intergenic
1107359295 13:39602500-39602522 GGGGGTGGCCTGCGGGCAGGGGG + Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108376730 13:49820950-49820972 CAGGGTGACCTGAGGCCATGGGG - Intergenic
1110218092 13:73045535-73045557 CAGGGTGGCCTAATGGCACGTGG - Intergenic
1110506692 13:76295285-76295307 CGGGGTCGCCGCAGGGCAGAGGG - Intergenic
1111390908 13:87593331-87593353 ATGGGTGGTTGGAGGGCAGGTGG + Intergenic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113329199 13:109311850-109311872 CGGGGTGGCGGTAGGGCAGAGGG - Intergenic
1113388456 13:109873067-109873089 CAGGGCGCACTGAGGGCAGGAGG + Intergenic
1113616742 13:111685657-111685679 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113622272 13:111770928-111770950 CAGGCTGGTGGGAGTGCAGGTGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113676786 13:112213242-112213264 CAGGGTGGGAGCAGGGCAGCAGG + Intergenic
1113799879 13:113080781-113080803 CAGGGAGGCCGGGCAGCAGGCGG + Intronic
1113826274 13:113256531-113256553 CAGGGTGAGCGAAGGACAGGTGG - Intronic
1113868234 13:113543103-113543125 CAGGGAGGGCTGGGGGCAGGGGG - Intronic
1113868329 13:113543347-113543369 CAGGGAGGGCGGGGGGCAGGGGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113922544 13:113921670-113921692 CAGGGTGGGCGAAGGGCAGGGGG - Intergenic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1113938586 13:114007259-114007281 GAGGGGGGCGGCAGGGCAGGAGG - Intronic
1113961886 13:114130822-114130844 CACGGGGGCAGGAGGGCTGGAGG - Intronic
1114474170 14:22982290-22982312 CAGGGTGCCAGGCGGGGAGGGGG - Exonic
1114531035 14:23396654-23396676 CTGGGTGGTTGCAGGGCAGGTGG - Intronic
1114570472 14:23663809-23663831 CAGGGTGGGCGGGGGGCTTGGGG + Intergenic
1114627193 14:24137292-24137314 TAGGGTGGGAGGAGGGCTGGAGG - Intronic
1115271645 14:31560055-31560077 CAGGGTGGCGGCTGGGCAGAGGG + Intronic
1115519109 14:34215036-34215058 CAGGCAGGCAGGCGGGCAGGCGG + Intronic
1115678673 14:35711705-35711727 CAGGGTGGTTGGAGTTCAGGTGG - Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116997362 14:51337608-51337630 CAGGGTGGGCGGAGCTCAGGTGG + Intergenic
1117261011 14:54033413-54033435 CAAGGTGGCAGAAGGGCTGGGGG - Intergenic
1118225027 14:63890571-63890593 GAGGGAGACAGGAGGGCAGGTGG + Intronic
1118307037 14:64663396-64663418 CAGGAAGGCAAGAGGGCAGGTGG + Intergenic
1118332513 14:64825162-64825184 AAGGGTTTCAGGAGGGCAGGTGG + Intronic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1118658932 14:67985818-67985840 CAGGATGGCTGGAGCTCAGGAGG + Intronic
1119206375 14:72797133-72797155 CAGGGTTCCCGGAGAGCAGAAGG - Intronic
1119440368 14:74624153-74624175 GAGGGAGGCCGAAGAGCAGGTGG - Intergenic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1120795865 14:88632252-88632274 CAGGGTGGCAGGAGTGAATGTGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121242577 14:92440916-92440938 CAGGGAGGAGGGAGGACAGGAGG + Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121632583 14:95432019-95432041 CAGGGTGCCTGGAGGGTTGGTGG - Intronic
1122201829 14:100127501-100127523 CAGACTGGCCGGGGAGCAGGAGG - Intronic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122696564 14:103556123-103556145 CAGGCAGGCCTGGGGGCAGGTGG - Intergenic
1122707506 14:103629932-103629954 CGGGGAGGCCGGAGGCCCGGCGG + Intronic
1122721966 14:103727354-103727376 CAGAGGGGGCGGGGGGCAGGTGG - Intronic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122847152 14:104506281-104506303 CAGGGAGGCAGGAGAGGAGGAGG - Intronic
1122874288 14:104656384-104656406 CATGGTGGCGGCAGGGGAGGTGG + Intergenic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122970546 14:105150440-105150462 CTGGGTGCCAGGTGGGCAGGCGG - Intronic
1123011379 14:105351089-105351111 CCAGGTGGCTGGAGGGCGGGCGG - Intronic
1123407286 15:20028698-20028720 GAGGGTGGCTTGAGGCCAGGAGG - Intergenic
1123516613 15:21035354-21035376 GAGGGTGGCTTGAGGCCAGGAGG - Intergenic
1123711339 15:22989978-22990000 CAGGGAAGCCCCAGGGCAGGAGG - Intronic
1123992699 15:25695260-25695282 GAGGGTGGCCTCTGGGCAGGCGG - Intronic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124469380 15:29969131-29969153 CAGGGCGGCCGGCGCGCAGGTGG - Intergenic
1125557068 15:40594625-40594647 CCGGGTGGCCGGAGGGGCCGAGG - Intronic
1125606489 15:40942308-40942330 CAGGATGGCCGGAGGCCTGTTGG - Intergenic
1125740771 15:41962760-41962782 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1127898317 15:63321911-63321933 GAGGGAGACAGGAGGGCAGGAGG - Exonic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128806663 15:70536202-70536224 GAGGGTGGCCTGGGTGCAGGAGG - Intergenic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129333192 15:74838220-74838242 CAGGGTGGCCAGAGGCCCTGTGG + Intronic
1129737610 15:77974890-77974912 CTGGGTGGCCTTAGGGCAGGTGG - Intergenic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1129889943 15:79065394-79065416 CAGGGATGCCAGTGGGCAGGTGG + Intronic
1130321972 15:82849124-82849146 CTGGGGGGGCGGGGGGCAGGGGG + Exonic
1131148875 15:90034668-90034690 TAGGGTAGCAGGAGAGCAGGCGG - Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131714338 15:95091832-95091854 AAGGCTGGACTGAGGGCAGGTGG + Intergenic
1132231080 15:100184731-100184753 CATGATGGACGGAGGGAAGGTGG - Intronic
1132420441 15:101661329-101661351 AAGGATGGCTGGAGGGCAAGAGG + Intronic
1132470473 16:100077-100099 TGGGGAGGCCGGAGGGCTGGAGG - Intronic
1132506701 16:313615-313637 TAGGATGGCTGGTGGGCAGGTGG + Intronic
1132588037 16:714781-714803 CGGGGTGGCGGTAGGGAAGGTGG - Intronic
1132650801 16:1020708-1020730 GAGGGTGGAGGGAGGGCAGGCGG + Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132679635 16:1134422-1134444 CAGGGATCACGGAGGGCAGGGGG + Intergenic
1132685266 16:1159444-1159466 CAGGGTGGGCCGTGGGGAGGAGG + Intronic
1132728433 16:1348803-1348825 CTGGGTGGGCGGTGGGCAGCTGG + Exonic
1132746587 16:1438786-1438808 CCGGGCGGGCGGCGGGCAGGTGG - Exonic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1132846232 16:2002084-2002106 CAGCCTGGCCGGAGGGTGGGAGG + Intronic
1132953535 16:2578465-2578487 TAGGGTGGCTGGGAGGCAGGTGG + Intronic
1132960817 16:2621702-2621724 TAGGGTGGCTGGGAGGCAGGTGG - Intergenic
1133128784 16:3663628-3663650 GAGGGCGGCAGGAGGGCTGGGGG + Exonic
1133237131 16:4392597-4392619 GAGGTTGGATGGAGGGCAGGCGG + Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134250821 16:12572598-12572620 GGGGGTAGCCGGAGGGGAGGGGG - Exonic
1136005702 16:27327311-27327333 GCGGGTGGCAGGGGGGCAGGGGG - Intronic
1136542477 16:30935807-30935829 CGGGGTGGCTGGAGTCCAGGAGG + Intronic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1137531903 16:49283153-49283175 TAGGGCGGCGGGAGGGCGGGGGG + Intergenic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1138352425 16:56353095-56353117 CAGGATGGAGTGAGGGCAGGAGG + Intronic
1138537671 16:57668420-57668442 CAGCGTGGCAGGAGGGGATGAGG - Intronic
1138551662 16:57752029-57752051 CAGAGCTGCCGGAGGCCAGGAGG - Exonic
1138565984 16:57833229-57833251 CAGGATGCCAGGAGGGCAGAGGG + Intronic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1138704278 16:58898396-58898418 CTGGGAGGCCGGGGGCCAGGGGG - Intergenic
1139581927 16:67878881-67878903 GAGGAAGGCCGGGGGGCAGGTGG + Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1140014063 16:71165003-71165025 CAGGGTGGCGGGGGTGGAGGTGG - Intronic
1140043673 16:71425827-71425849 GAGCGCGGCAGGAGGGCAGGAGG - Intergenic
1140221560 16:73047964-73047986 CATGGTGGCGGCAGGGCTGGCGG + Exonic
1140420584 16:74815756-74815778 CAGGGTGGCCGCAGTGGAAGTGG + Intergenic
1140693429 16:77507530-77507552 CAGGGTGGAGGGAGAGCAGGGGG + Intergenic
1141471153 16:84239610-84239632 TAGGGTGGGCGGGGGCCAGGGGG - Intronic
1141509872 16:84505155-84505177 GAGGGAGGCCCGAGGGGAGGCGG - Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1141638899 16:85329847-85329869 TGGGGAGGGCGGAGGGCAGGAGG + Intergenic
1141664527 16:85459007-85459029 CAGGGTGGCAGGAGCGAAAGCGG - Intergenic
1141697625 16:85627666-85627688 CCGGGGGGCCGGGGGGCCGGGGG - Intronic
1141703109 16:85651405-85651427 CAGGGAGTCCGGGGGGCTGGGGG - Intronic
1141940596 16:87273539-87273561 CAGGGAGGTCGGGGGGCAGGGGG + Intronic
1142005976 16:87689802-87689824 CGGGGTGGCCGCGGGGCTGGTGG - Exonic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142176410 16:88647447-88647469 GAGGGTGGCCTGAGCCCAGGTGG + Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1142547390 17:714522-714544 GCGGGTGGACGGAGGGCCGGGGG - Intronic
1142559727 17:802889-802911 ATGGGTGGATGGAGGGCAGGGGG + Intronic
1142604638 17:1074688-1074710 CAGGGAGGCTGGAGGCCAGGAGG + Intronic
1142621160 17:1166478-1166500 CAGTGTGGCCGGAGGCCCGGGGG + Intronic
1142709570 17:1715864-1715886 CCGAGGGGCCGGAGGGCCGGGGG - Intergenic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142759431 17:2034548-2034570 GAGGGTGGCAGCAGGGGAGGGGG - Intronic
1142812245 17:2400776-2400798 CAGGCTGGCGGGCAGGCAGGAGG + Exonic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143186342 17:5012661-5012683 AGGGGTGGCAGGAAGGCAGGTGG + Intronic
1143586261 17:7852123-7852145 CGGGGTGGCCACAGGTCAGGTGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143965735 17:10755538-10755560 CAGGGTTGCGGGATGGGAGGTGG - Intergenic
1144447684 17:15346077-15346099 CAGAGTGGCCACAGAGCAGGTGG + Intergenic
1144510002 17:15867497-15867519 CAGAGTGGCCGCCGGGCAGAGGG - Intergenic
1144517511 17:15928857-15928879 CAGAGTGGCTGGAGGTCTGGAGG + Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1144848077 17:18230384-18230406 GAGGGTGGCAGGTGGGCTGGGGG + Intronic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1144876234 17:18398920-18398942 CTGGGCAGCTGGAGGGCAGGAGG - Intergenic
1144966249 17:19078525-19078547 CTGGATGGAAGGAGGGCAGGGGG + Intergenic
1144981669 17:19173532-19173554 CTGGATGGAAGGAGGGCAGGGGG - Intergenic
1144986555 17:19204707-19204729 CTGGATGGAAGGAGGGCAGGGGG + Intergenic
1145155994 17:20545500-20545522 CTGGGCAGCTGGAGGGCAGGAGG + Intergenic
1145235095 17:21202560-21202582 CAGGGGGGCCGGAGGGGGTGAGG - Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146843459 17:36169568-36169590 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146855767 17:36257506-36257528 CTGGGCAGCTGGAGGGCAGGAGG + Intronic
1146864853 17:36330869-36330891 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1146871674 17:36381417-36381439 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146879033 17:36432499-36432521 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1146882974 17:36453645-36453667 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1147067712 17:37931463-37931485 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1147074560 17:37982041-37982063 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1147079243 17:38011018-38011040 CCGGGCAGCTGGAGGGCAGGAGG - Intronic
1147086083 17:38061580-38061602 CCGGGCAGCTGGAGGGCAGGAGG + Intronic
1147095182 17:38134960-38134982 CCGGGCAGCTGGAGGGCAGGAGG - Intergenic
1147102028 17:38185545-38185567 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147988961 17:44321870-44321892 CAGGGAGGCCTGAGGGCTGTGGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148465955 17:47865477-47865499 CAGGGTGGCTTGGAGGCAGGAGG - Intergenic
1148565559 17:48631017-48631039 CGGGGTGGGCGGCAGGCAGGCGG + Intronic
1148618434 17:49016803-49016825 CGGGGGGGCAGGAGGACAGGGGG - Intronic
1148678856 17:49461391-49461413 CATGGTGCCCGGCTGGCAGGAGG - Intronic
1148742813 17:49902282-49902304 CCGGGTGGTCGCAGAGCAGGAGG + Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1148887907 17:50786841-50786863 TAGGGTGGCCGCAGCGGAGGTGG - Intergenic
1149424964 17:56546007-56546029 GAGGGTGGGGGGAGGGGAGGAGG + Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149846619 17:60012055-60012077 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1150084966 17:62268630-62268652 CCGGGCAGCTGGAGGGCAGGAGG + Intergenic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1150287657 17:63963041-63963063 TAGGGAGGCAGGAGGGAAGGAGG - Intronic
1150676076 17:67246222-67246244 CAGTGTGGCCGGCGGGCTGGGGG - Intergenic
1151701231 17:75743638-75743660 CAGGGTCACAGGAGAGCAGGAGG + Intronic
1151747234 17:76018133-76018155 CAGGGTGGCCCGGGGAGAGGTGG - Intronic
1152234322 17:79130585-79130607 CACAGTGGCGTGAGGGCAGGCGG + Intronic
1152245387 17:79182544-79182566 CCGGCCGGCCGGCGGGCAGGCGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152587891 17:81197177-81197199 GTGGGAAGCCGGAGGGCAGGTGG + Intronic
1152615076 17:81334201-81334223 GAGGGAAGCCTGAGGGCAGGGGG - Intergenic
1152629859 17:81406054-81406076 GAGGGTGTCAGGAGGGCAAGGGG - Intronic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1152794306 17:82299327-82299349 CAGGCCGGCGGGAGGGCAGCGGG + Intergenic
1152800359 17:82328007-82328029 CAGGGTGGTGGGGGGGCTGGTGG - Intronic
1203167025 17_GL000205v2_random:106846-106868 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1153475787 18:5497139-5497161 CAGGGTAGCTGGAATGCAGGGGG + Intronic
1153991798 18:10406803-10406825 GAGGGAGGACGGAGCGCAGGTGG - Intergenic
1154283706 18:13031982-13032004 GAGAGTGGCCGGAGGCTAGGAGG + Intronic
1155157508 18:23169919-23169941 ATGGGCAGCCGGAGGGCAGGTGG + Intronic
1155336492 18:24770387-24770409 AAGGGGGCCAGGAGGGCAGGTGG - Intergenic
1157455980 18:47828399-47828421 CAGGGTGGCGGCCGGGCAGAGGG - Exonic
1157492776 18:48136072-48136094 CGGGGTGGGCGGCGGGCAGGGGG + Intronic
1157601163 18:48894013-48894035 CAGGGTGCCAGGCGGGCAGCCGG - Intergenic
1157606525 18:48929422-48929444 CAGGGTGGCAGGTGGGTAGGTGG - Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157857638 18:51117083-51117105 CAGGGTGGCGGCTGGGCAGAGGG + Intergenic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160079021 18:75704883-75704905 CAGGAAGGACGGATGGCAGGAGG + Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160150212 18:76392590-76392612 CCGGGTGGGGGAAGGGCAGGTGG + Intronic
1160150223 18:76392625-76392647 CCAGGTGGAGGGAGGGCAGGCGG + Intronic
1160256366 18:77251245-77251267 GAGGGAGGGCGGAGGGCCGGTGG + Intronic
1160450944 18:78965586-78965608 CAGCATGGTGGGAGGGCAGGGGG - Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160554053 18:79714751-79714773 CAGGGTGGCCGGGTGGCACCGGG + Exonic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160682952 19:420319-420341 CACGGCGGCGGGCGGGCAGGTGG - Intronic
1160719499 19:590971-590993 CAGGGAGGCCGGGGGAGAGGGGG + Intronic
1160910998 19:1473786-1473808 CAGGGTGGAAGGTGGGGAGGGGG - Exonic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160969733 19:1762264-1762286 GAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161077697 19:2294366-2294388 CAAGGTGTCCGCAGGGCCGGGGG - Intronic
1161125055 19:2551115-2551137 CAGCGTGGCTGGACGGCAGGTGG - Intronic
1161152550 19:2717176-2717198 GGGGGTGGGCGGCGGGCAGGCGG + Exonic
1161153941 19:2722680-2722702 CAGAGTGGAAGGAGGGCTGGAGG - Intronic
1161154532 19:2725781-2725803 CATGGTGGCCTGGGGGCTGGGGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161397580 19:4052614-4052636 CAGGGCGGGCGGGGGGCAGGGGG + Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1161575041 19:5050445-5050467 CGGGGGGGCCGGAGTGCAGGTGG + Intronic
1161589022 19:5120456-5120478 TGGGGAGGCCCGAGGGCAGGTGG - Intronic
1161612652 19:5251694-5251716 CAGGGTGGGCGGCGAGGAGGGGG - Intronic
1161770848 19:6230027-6230049 CAGGGTGGGCGCAGGGCTGGTGG - Intronic
1161906105 19:7157724-7157746 CAGAGTGGCAGCAGGGGAGGTGG - Intronic
1161989930 19:7678814-7678836 CAGGGTGGGTGTGGGGCAGGGGG + Intronic
1162421053 19:10566212-10566234 CTGGGTGCCCGGAGCACAGGGGG - Intergenic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1162801379 19:13112658-13112680 CAGGGAGACCGGGGGACAGGTGG - Intronic
1162818140 19:13208244-13208266 CAGGGAGGAGGGAGGGGAGGAGG + Intronic
1162926276 19:13931934-13931956 GAGGGTGACCGGAGGGGTGGAGG - Intronic
1163424950 19:17236091-17236113 CATGGGGGCGGGAGGGGAGGCGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1163986060 19:20952577-20952599 CAGGGTGGCGGCCGGGCAGAGGG + Intergenic
1164105403 19:22105505-22105527 CAGGGTGGCGGCCGGGCAGAGGG - Intergenic
1165107765 19:33483904-33483926 CTGGCTGGCAGGAGGACAGGAGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165767084 19:38358355-38358377 CAGGGTGGCTGTGGGCCAGGAGG + Intronic
1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG + Intergenic
1165940126 19:39410664-39410686 CAAGGAGGCCTGAGAGCAGGAGG - Intergenic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166000904 19:39876927-39876949 CGTGCTGGCCGGATGGCAGGAGG + Exonic
1166003685 19:39893180-39893202 CGTGCTGGCCGGATGGCAGGAGG + Exonic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166092180 19:40516858-40516880 CAAGGTGGGAGGAGGCCAGGAGG - Intronic
1166231443 19:41427495-41427517 GAGGGAGGGAGGAGGGCAGGAGG + Exonic
1166275335 19:41749683-41749705 CAAAGTGGCAGGAGTGCAGGGGG - Intronic
1166329593 19:42070246-42070268 CAGGGAGGAGGGCGGGCAGGAGG + Intronic
1166396382 19:42444264-42444286 CAAAGTGGCAGGAGTGCAGGGGG + Intergenic
1166683314 19:44781237-44781259 CAGGGTGGCAGGTGCCCAGGAGG - Exonic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167169593 19:47822258-47822280 CAGGGTGGCTTGTGGGCAAGGGG + Intronic
1167367293 19:49061534-49061556 GAAGGTGGCCCGGGGGCAGGTGG - Exonic
1167373872 19:49101078-49101100 CCCGGGGGCAGGAGGGCAGGAGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167625028 19:50582432-50582454 CAGGGTGGCGGCCGGGCAGAGGG + Intergenic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1168076314 19:53982519-53982541 CAGCGTGGCCGCGGGGCTGGCGG + Exonic
1168183380 19:54679289-54679311 AAGGGTGGGAGGAGGGCAAGAGG + Intronic
1168239577 19:55082360-55082382 CAGGGGGGCCCGAGGGCCTGGGG - Intronic
1168266789 19:55227778-55227800 CAGAGTGGCTGGAGAGCTGGAGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925017619 2:543730-543752 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017690 2:543929-543951 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017700 2:543959-543981 CAGGGAGGCAGGGAGGCAGGAGG + Intergenic
925017704 2:543967-543989 CAGGGAGGCAGGAGGGTGGGAGG + Intergenic
925047356 2:782756-782778 AAGGGAGGCCGGTGGGCAGAAGG + Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925216958 2:2104789-2104811 CATGGTTGGGGGAGGGCAGGAGG + Intronic
925740697 2:7003776-7003798 CAGAGTGGCCACATGGCAGGTGG - Intronic
925969643 2:9097234-9097256 CTGGGTGGCAGGGAGGCAGGGGG + Intergenic
926210061 2:10862858-10862880 CAGGGAGGCCGGCTGGGAGGTGG + Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927519755 2:23691624-23691646 CACGGTGGCCGCAGGGCAGGAGG + Intronic
927717271 2:25360837-25360859 ACGGGTGGCGGGAGGGCAGGTGG - Intergenic
927779389 2:25927282-25927304 CCAGGTGGCCTGAGCGCAGGGGG - Exonic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
927945731 2:27134211-27134233 CAGGGTGGCCGGGGGGTCGCGGG - Intronic
928173770 2:29020668-29020690 AAGGGGGGCAGCAGGGCAGGTGG + Intronic
928360060 2:30655474-30655496 GAGAGTGGTCGGAGGGGAGGAGG + Intergenic
928410691 2:31051909-31051931 TTGGGTGGGCGGAGGGGAGGGGG - Intronic
928622887 2:33108728-33108750 CAGGGTGGCAGCATGGCCGGAGG + Intronic
929515932 2:42605495-42605517 CGGGGCGGCTGGCGGGCAGGGGG + Intronic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
929773281 2:44911109-44911131 CATGGTGGCAGGAGGGGAAGGGG + Intergenic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
931226892 2:60339507-60339529 CATGATGGGTGGAGGGCAGGTGG - Intergenic
932572642 2:72946054-72946076 TGGGGTGGGAGGAGGGCAGGTGG - Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934620273 2:95799314-95799336 GATGGTGGCCTGAGGCCAGGAGG + Intergenic
934640619 2:96025249-96025271 GATGGTGGCCTGAGGCCAGGAGG - Intronic
934853860 2:97717244-97717266 CAGGGTGGTGGGGGGGCAGTAGG + Intronic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935293371 2:101628062-101628084 CAGGGTGCCCGGTGTGCAGCAGG - Intergenic
935378587 2:102425448-102425470 CAGGGTGGACGAACGGCATGGGG + Intronic
935578392 2:104734557-104734579 CAGGGTATCCCCAGGGCAGGAGG - Intergenic
935725980 2:106024483-106024505 TAGTGTAGGCGGAGGGCAGGAGG - Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
936504355 2:113093274-113093296 CAGCATGGCCGGGGAGCAGGAGG - Intergenic
937658566 2:124404592-124404614 CTGAGTGGCAGAAGGGCAGGGGG + Intronic
938055228 2:128209306-128209328 CGGGGTGGCGGCAGGGCAGAGGG - Intergenic
938072885 2:128317725-128317747 TAAGGTGGCCCGAGGGCAGCGGG + Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938240262 2:129737918-129737940 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938388283 2:130883236-130883258 GAGGGTGGCCAGTGGGCATGGGG + Intronic
938598754 2:132815969-132815991 CAGGGAGGCAGGAAAGCAGGTGG + Intronic
938860580 2:135364083-135364105 CAGGAAGGAAGGAGGGCAGGAGG + Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939818100 2:146921437-146921459 CAGGGTGGGTGGATGGGAGGAGG + Intergenic
940257221 2:151743750-151743772 CAAGGTGGCAGCAGGGCTGGGGG + Intergenic
940453707 2:153871763-153871785 CAGGGAGGGAGGAGGGCTGGGGG + Intergenic
940817206 2:158310451-158310473 CAGGGTGGCGGCCGGGCAGAGGG + Intronic
941005842 2:160246101-160246123 CATGGTGGTCAGAGGCCAGGGGG + Intronic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
942055923 2:172181964-172181986 CAGGGAGGCTGAGGGGCAGGCGG + Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
943219162 2:185082562-185082584 CATGGTGGCAGGAGAGAAGGCGG - Intergenic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
943811521 2:192194798-192194820 CTGGGAAGCCGGAGGACAGGAGG + Exonic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
946354572 2:219176904-219176926 CAGGCTGGCAGGTGGACAGGCGG - Intronic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946410500 2:219513046-219513068 CGGGGTGGCCGTTGGGCAGCGGG + Intergenic
947152030 2:227125606-227125628 CAGGGTGGCAGGCTGGGAGGAGG - Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948691939 2:239711661-239711683 ATGGGAGGCCGGAGGGCAGAGGG - Intergenic
948701990 2:239766339-239766361 CAGGGTGGCCGGACACCTGGAGG - Intronic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
948895596 2:240925480-240925502 CAGGGAGGCAGGAGGGCACTGGG + Intronic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1168849553 20:967202-967224 CAAAGTGCCCGGCGGGCAGGTGG + Exonic
1169367170 20:5001212-5001234 CAGGGTGGCCGGCGGGCGCGGGG + Intronic
1170219610 20:13928325-13928347 CAGGGAGGTGGGAGAGCAGGAGG + Intronic
1170989492 20:21288721-21288743 CAGGATGGCCTGAGCCCAGGAGG + Intergenic
1171175957 20:23050748-23050770 CAGGGTGGGGGGGGGGCTGGAGG + Intergenic
1171947157 20:31388900-31388922 GAGGGTGGGGGGATGGCAGGGGG - Intronic
1172426591 20:34860044-34860066 TGGGGGGGCCGGAGAGCAGGGGG + Intronic
1172650629 20:36499363-36499385 CAGGCGGGCGGGCGGGCAGGTGG - Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1172893470 20:38283473-38283495 GATGGTGGACGGAGGGCATGGGG + Intronic
1173229783 20:41185244-41185266 CAGGCTGCCTGGGGGGCAGGTGG - Intronic
1173564618 20:44029965-44029987 AAGGGTGGCCTGAGGGGTGGAGG - Intronic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174423423 20:50415667-50415689 CAGGCCGGGCGGCGGGCAGGCGG + Intergenic
1174430396 20:50464299-50464321 CAGGGCGGAGGGAGGACAGGAGG + Intergenic
1175164187 20:57031478-57031500 CAGGGCAGCCGGTGGACAGGCGG - Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1176040107 20:63060767-63060789 CAGGGTGCCCGGAAGGCGGAAGG + Intergenic
1176045557 20:63090933-63090955 GAGGGTGTCAGGTGGGCAGGTGG - Intergenic
1176093383 20:63328809-63328831 CAGGAGGGCGGGAGGGCGGGAGG - Intronic
1176137522 20:63530686-63530708 GGGCGTGGCCGGAGGGCTGGGGG - Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176296207 21:5074879-5074901 CTGGGTGGCCTGAGGGCAACTGG + Intergenic
1176296668 21:5076743-5076765 CAGGGCACCCGGAGGGCACGGGG + Intergenic
1176334542 21:5583714-5583736 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176385759 21:6137934-6137956 CTGGGATGGCGGAGGGCAGGTGG + Intergenic
1176393215 21:6237234-6237256 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1176468204 21:7078940-7078962 CAGGTTGGCAGGAGGGTAGAAGG + Intronic
1176491765 21:7460718-7460740 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176508877 21:7677665-7677687 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1178377061 21:32075543-32075565 AAGTGTGGCCGGGGGGCGGGGGG - Intergenic
1178466189 21:32850195-32850217 GAGGGGGGCGGGAGGGGAGGAGG + Intergenic
1178707331 21:34886807-34886829 GAGGGTGGTGGGAGGACAGGCGG - Intronic
1178829685 21:36045435-36045457 CAGGTTGGCCTGACGTCAGGAGG - Intronic
1178913422 21:36693872-36693894 CAGAAAGGCCGGCGGGCAGGCGG - Intergenic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179374822 21:40841235-40841257 CAAGGTGGCAGGAGGGAAGCAGG - Intronic
1179737714 21:43400318-43400340 CTGGGATGGCGGAGGGCAGGTGG - Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179860381 21:44185378-44185400 CAGGGCACCCGGAGGGCACGGGG - Intergenic
1179860842 21:44187242-44187264 CTGGGTGGCCTGAGGGCAACTGG - Intergenic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1179928111 21:44549796-44549818 CTGGGTGGGCGGAGGGCCGGTGG - Intronic
1179939583 21:44628933-44628955 CTGGGTGGGTGGAGGGCCGGTGG + Intronic
1180056216 21:45360399-45360421 CAGGGAGGCAGGAGGGCCCGGGG + Intergenic
1180182628 21:46124731-46124753 CAGGTTGGGGGGAGGGCATGGGG - Intronic
1180184316 21:46131912-46131934 CGGGCTGGGCGGAGGGGAGGTGG - Intronic
1180224832 21:46386195-46386217 CAGGGTGGGAGGAGGGCACGGGG - Intronic
1180699985 22:17775984-17776006 TGGGGTGGCCTGAAGGCAGGAGG + Intergenic
1180725564 22:17944371-17944393 CAGGGTTCCAGGAGAGCAGGGGG + Intronic
1181001006 22:19987714-19987736 CAGAGTGGCGGCTGGGCAGGAGG - Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181482560 22:23209852-23209874 GAGGATGGCCTGAGGCCAGGAGG - Intronic
1181537501 22:23554204-23554226 CAGGGTGCCCGGGAGGCATGAGG - Intergenic
1181640042 22:24191507-24191529 GTGGGAGGCTGGAGGGCAGGGGG - Intergenic
1181829081 22:25544979-25545001 GAGGATGGCCTGAGGCCAGGAGG - Intergenic
1182321339 22:29480101-29480123 CCGGGGGGCCGCAGGGGAGGAGG + Intergenic
1182426943 22:30278572-30278594 CAGGGAGGCCTGAGGGCATGTGG + Intergenic
1182890728 22:33816621-33816643 CAGGCAGGCGGGAGGGCGGGTGG + Intronic
1183309829 22:37103375-37103397 CCAGGTGGCTGGCGGGCAGGGGG - Exonic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183385068 22:37509807-37509829 CAGGCTGGCAGGAGGTCAGGAGG - Intronic
1183385111 22:37509926-37509948 CAGGCTGGCAGGAGGTCAGGAGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1183455213 22:37918866-37918888 CAGGAGGGGCAGAGGGCAGGAGG - Intronic
1183587452 22:38761092-38761114 CAGGGAAGCCGGAGGGCTGGTGG + Intronic
1183606279 22:38868290-38868312 CAGGGAGGACGGTGGGCAGTGGG + Intronic
1183829539 22:40410469-40410491 CAGCGTGGCCCTAGGACAGGAGG - Exonic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184248157 22:43246011-43246033 CAGGGAGGCCTGAGGGCTGGTGG + Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184471167 22:44697286-44697308 CAGGGTGGTCGCACGGCAGAAGG - Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184590113 22:45476398-45476420 CAGCGTGGCAGGGGGACAGGGGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185015345 22:48339538-48339560 CTGGGTTGCTGGAGTGCAGGCGG - Intergenic
1185017699 22:48354514-48354536 GAGGGAGGCAGGAGAGCAGGTGG + Intergenic
1185111489 22:48902514-48902536 CAGGGTCTCGGGAGGGGAGGAGG + Intergenic
1185215986 22:49600241-49600263 CGTGGTGGAGGGAGGGCAGGTGG - Intronic
1185312355 22:50163093-50163115 CAGGGTGGCAGGAGACCAGGCGG + Intergenic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
1185371738 22:50464177-50464199 TGGGCTGGCCGGAGGGTAGGTGG - Intronic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950424877 3:12919749-12919771 CAGGGTCCCCGGAAGGAAGGAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
950577726 3:13842804-13842826 CAGGGAGGCAGGATGGCAGCTGG + Intronic
950991355 3:17441538-17441560 CAAGGTGGCTGGAGGACTGGGGG + Intronic
952849677 3:37717565-37717587 CATGGTGGCAGGAGAGAAGGGGG + Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
952885431 3:38008763-38008785 GAGGGTGGCAGGAGGGCAGCAGG - Intronic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
953698721 3:45179806-45179828 TAGGGTGCCCTGCGGGCAGGGGG - Intergenic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954689829 3:52389729-52389751 GAGGGTGGTAGGAGGACAGGAGG + Intronic
955670020 3:61393472-61393494 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
955953360 3:64263985-64264007 CAGAGTGGCGGCAGGGCAGTGGG + Intronic
958453861 3:94306075-94306097 CGGGGTGGCGGGGGGGCGGGGGG + Intergenic
959575359 3:107927653-107927675 CAGGGTGGCGGGAGGACCAGTGG + Intergenic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961385593 3:126521656-126521678 GAGGGTGCCCCGAGGGCTGGAGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961512134 3:127409591-127409613 CACGGGGGCCGGGGGACAGGAGG - Intergenic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961660952 3:128468604-128468626 CAGGGTGGCCGGGGGTGGGGTGG - Intergenic
961662199 3:128475360-128475382 CTGGGTCACCGGGGGGCAGGAGG + Intergenic
961667924 3:128505148-128505170 CATGGTGGCCTCAGGGCAGTTGG - Intergenic
962321811 3:134396719-134396741 GAGGCTGGCAGGAGGGCAGCAGG - Intergenic
962422173 3:135238400-135238422 CAAGGTGGCAGGAGGGCTGTAGG + Intronic
962531093 3:136280974-136280996 CATGGAGGCCGGAAGGCAGTGGG - Intronic
962761880 3:138521751-138521773 CAGGGTGGCGGCCGGGCAGAAGG - Intronic
962945497 3:140165523-140165545 CAGGGTGACGGGAGAACAGGAGG + Intronic
963790506 3:149577998-149578020 GAGGGTGGGGGGAGGGAAGGAGG - Intronic
966767992 3:183479417-183479439 AAGGGTGGAGGGAGGGCAGCGGG - Intergenic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967176252 3:186864715-186864737 CAGGGCGGCCGGCCGGAAGGGGG - Intergenic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
967337911 3:188364759-188364781 AATGGTGGCCAGAGGGCAGCAGG - Intronic
967429168 3:189361699-189361721 CAGGGTGGGGGGGGGGCTGGGGG - Intergenic
968047349 3:195631722-195631744 CGGGGTGGCGGGGGGGCGGGTGG - Intergenic
968076365 3:195817785-195817807 CAGGGAGGCGGGCGGGCTGGAGG + Intergenic
968173798 3:196531333-196531355 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
968278460 3:197458325-197458347 CAGGGTGAGTGGAGGGCATGTGG - Intergenic
968307264 3:197658202-197658224 CGGGGTGGCGGGGGGGCGGGTGG + Intergenic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
968423660 4:506338-506360 CATCGTGCCCTGAGGGCAGGTGG + Intronic
968484168 4:850720-850742 CAGGGTGGCCTGAGGCCAGGGGG - Intronic
968698196 4:2042696-2042718 CAGGGTGGAGGGGGCGCAGGGGG - Intronic
968731534 4:2271515-2271537 GAGGCTGGCTGGAGGCCAGGCGG - Intronic
968770304 4:2501413-2501435 CAGGGAGGCTGGAGCCCAGGAGG + Intronic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969057205 4:4409527-4409549 AGGGGTGGCCGGAAGGCAGCAGG - Intronic
969212992 4:5701962-5701984 CAGGCAGGCGGGAGGCCAGGGGG - Intronic
969220328 4:5754857-5754879 AAGTGTTGACGGAGGGCAGGCGG - Intronic
969222488 4:5770296-5770318 CAGGGAGGCCTTAGGGCATGTGG - Intronic
969240330 4:5893001-5893023 CAGGGCCGCGGGCGGGCAGGCGG - Exonic
969307870 4:6336014-6336036 CCGGGTATCCTGAGGGCAGGTGG + Intronic
969310148 4:6348251-6348273 GAGGGGGGCCGCAGGTCAGGAGG - Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969465846 4:7355940-7355962 AAGGGAGGGCAGAGGGCAGGTGG - Intronic
969467769 4:7367894-7367916 CCGGGTGGCAGGAGGGCTGGGGG - Intronic
969715868 4:8867834-8867856 CAGGGTGGCCGGGGGCCCAGCGG + Exonic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
972337825 4:38123620-38123642 CAGGGTGGCCGCAGGAAAGTGGG - Intronic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
973760767 4:54113386-54113408 GAGGATGGCCTGAGGCCAGGAGG - Intronic
973791872 4:54385345-54385367 GAGGATGGCAGGAGGCCAGGAGG + Intergenic
973816390 4:54623263-54623285 CAGGGGGCCAGGAAGGCAGGAGG - Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
974597951 4:64037584-64037606 CAGGGTGGCGGCCGGGCAGAGGG - Intergenic
975811821 4:78177616-78177638 AGGGGTGGCCGTAGGGAAGGCGG + Intronic
976226396 4:82798267-82798289 CACGGAGGCCGGGGCGCAGGGGG + Intronic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
979941851 4:126771548-126771570 CAGGGTGGCGGCTGGGCAGAGGG - Intergenic
980056402 4:128083550-128083572 CGGGGCGGCTGGCGGGCAGGGGG + Intronic
981994929 4:150964212-150964234 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
983442952 4:167810604-167810626 CAAGGTGGGCAGAGGGCAAGCGG + Intergenic
983986248 4:174063518-174063540 GAGGGTGGCTTGAGGCCAGGAGG + Intergenic
984118501 4:175712313-175712335 TAGTGTGGCCGCAGGGCAGCAGG - Intronic
986278873 5:6306368-6306390 CTGGGTGGGCCGAGGGGAGGGGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986718526 5:10541246-10541268 CAGGGTGGAGGGATGCCAGGAGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
989505203 5:42218571-42218593 CGGGGTGGGCGGCAGGCAGGAGG + Intergenic
990316624 5:54589149-54589171 GAAGGTGACCGCAGGGCAGGGGG - Intergenic
990329157 5:54708222-54708244 CACGATGACAGGAGGGCAGGTGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990626134 5:57613347-57613369 AAGGATGGAAGGAGGGCAGGAGG + Intergenic
990977633 5:61573296-61573318 CAGGCTGGCCTCAGGGAAGGGGG - Intergenic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
993168439 5:84384922-84384944 CAGGGCGGGCGGAGGGCGGGCGG - Intergenic
993352381 5:86866311-86866333 CAGGATGGCAGGATGGTAGGAGG + Intergenic
994104045 5:95925807-95925829 CTGGGATGCCGGAGGGGAGGTGG - Intronic
995028077 5:107447676-107447698 CAGGATGGACGAAGGGGAGGGGG + Intronic
995236146 5:109832701-109832723 CAGGGTGGCGGCCGGGCAGAGGG + Intronic
996423264 5:123285654-123285676 AGGGGTGGGTGGAGGGCAGGAGG - Intergenic
997381902 5:133444374-133444396 CAGGGTGGCTGTAGGTAAGGAGG - Intronic
997672045 5:135683216-135683238 TGGGGTGGGAGGAGGGCAGGGGG + Intergenic
998295611 5:140966668-140966690 CAGGGTGGCACGAGCGGAGGCGG + Exonic
998386514 5:141760217-141760239 CAGGGAGGCTGTGGGGCAGGGGG + Intergenic
999113638 5:149142495-149142517 GAGGCTGGCCTGTGGGCAGGCGG + Intronic
999188218 5:149728582-149728604 TAGGGTGGGAGGAGGGCAGGAGG + Intergenic
999318827 5:150601024-150601046 CAGGGTGTCAGGGGGGCGGGCGG - Intergenic
999763700 5:154722384-154722406 CAGGCTGGTGGGTGGGCAGGAGG + Intronic
1000747015 5:165046153-165046175 CAAGGTGGCAGCAGGGCTGGGGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1000903242 5:166933615-166933637 CAGGATGGACCCAGGGCAGGCGG - Intergenic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1002052338 5:176578105-176578127 CAGGGTGGGCCGTAGGCAGGTGG + Intronic
1002094398 5:176822651-176822673 CAGGTTGGCCTGAGGCCAGCAGG - Intronic
1002176747 5:177404986-177405008 CAGGCTGGCAGGAGGCCGGGTGG - Intronic
1002450744 5:179317143-179317165 CAGAGTGACAGGAGGGCTGGAGG - Intronic
1002526068 5:179816859-179816881 CCGGGTGGCCGGAGACCCGGGGG - Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003171184 6:3723228-3723250 CAGGGTGGCTGGGGGGCACTAGG + Exonic
1003250075 6:4420079-4420101 CAGGCTGGCAGGAGGGGTGGTGG + Intergenic
1003495606 6:6660795-6660817 CAAGGTGGCATAAGGGCAGGAGG + Intergenic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1004396192 6:15248355-15248377 CAGGCGGGCAGGAGGGCGGGTGG + Intronic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1005860292 6:29895698-29895720 CAGGGTGGCGGCCGGGCAGAGGG + Intergenic
1006155540 6:32011088-32011110 GAGGGTGGGCAGAGTGCAGGGGG + Intergenic
1006161872 6:32043942-32043964 GAGGGTGGGCAGAGTGCAGGGGG + Intronic
1006335349 6:33417687-33417709 CAGAGAGGCCTGAGAGCAGGAGG + Exonic
1006480474 6:34289188-34289210 CAGAGACGCAGGAGGGCAGGAGG - Intronic
1007048837 6:38804910-38804932 GGGGGTGGCCGGGGGGGAGGGGG + Intronic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007429895 6:41770753-41770775 CAGGGTGGGTGGTGGGCATGGGG + Exonic
1007825660 6:44598886-44598908 CAGGGAGGCCTGTGGGAAGGAGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008106264 6:47443882-47443904 CAGGGTGGCGGCCGGGCAGAGGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1008568370 6:52791276-52791298 TAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008909811 6:56720881-56720903 CAGGGTGGCGGCCGGGCAGAGGG + Intronic
1009505882 6:64477563-64477585 AAGGGTGGCCGTGGGTCAGGAGG - Intronic
1011489302 6:87874257-87874279 CAGGAAGGCAGAAGGGCAGGAGG + Intergenic
1011750118 6:90446996-90447018 GAGGCTGGCTGAAGGGCAGGGGG + Intergenic
1011849515 6:91608698-91608720 GAGGGAGGGCTGAGGGCAGGAGG + Intergenic
1012887173 6:104859525-104859547 CAGGCTGGCCGCGGGGCTGGGGG - Intronic
1014123420 6:117751104-117751126 CAGGGTGGCGGCTGGGCAGAAGG - Intergenic
1014140640 6:117938516-117938538 CAGGGGGGCAGGTGGGCTGGGGG - Intronic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1017679211 6:156846667-156846689 CAGGGTGTCTGGAGAGCTGGAGG + Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1018893226 6:167996861-167996883 CGGCCTGGCCGGAGGGCAGAGGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019511831 7:1421608-1421630 CAGGGTGTCCCGAGGGCCAGGGG + Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1019676196 7:2314154-2314176 CAGGCGCGCAGGAGGGCAGGGGG + Intronic
1019697021 7:2451735-2451757 GAGGGTGGCCTCAGGGCTGGAGG - Intergenic
1020026730 7:4904883-4904905 CTGTGACGCCGGAGGGCAGGGGG + Intergenic
1020046719 7:5046082-5046104 CAGAGGGGCCGGACGGGAGGTGG + Exonic
1020096807 7:5374155-5374177 CGGGGTGGGCGGTGGGGAGGCGG + Exonic
1021030956 7:15735205-15735227 CAGGGTGGCCAGCCTGCAGGCGG - Intergenic
1021485040 7:21158214-21158236 CAGGGTGGCAGAAAGGAAGGAGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023411166 7:39890685-39890707 CAGGGCAGCAGAAGGGCAGGTGG - Intergenic
1023660738 7:42468714-42468736 CAGGGTGGGAGGAAGGCTGGGGG + Intergenic
1023845161 7:44116341-44116363 AAGGCAGGCAGGAGGGCAGGGGG - Intronic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1024305188 7:47922803-47922825 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
1025014474 7:55427855-55427877 CAGGGAGGGCTGAGGGCCGGGGG + Intronic
1025089692 7:56051881-56051903 CGAGGTGGCCCGAGCGCAGGCGG + Exonic
1025244414 7:57305495-57305517 CAGGGCGGAGGGAGGACAGGAGG - Intergenic
1025853366 7:65259375-65259397 CAGGGCGGCCGGCCGGAAGGGGG - Intergenic
1025901855 7:65751174-65751196 CAAGGTGGCCGGAGCGCAGGCGG + Intergenic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1026988534 7:74569895-74569917 CAGGGTGGCAGGCAGGCTGGGGG + Intronic
1026994657 7:74607624-74607646 GAGGGTGGCCCGAGGGGAGCAGG - Intergenic
1028937899 7:96486454-96486476 CAGGCTGGCAGGAGGTGAGGAGG + Intronic
1029159384 7:98540931-98540953 CAGGGAGTAGGGAGGGCAGGAGG + Intergenic
1029221628 7:98995107-98995129 CAGGAAGGCAGGAGGGCAGGAGG - Intronic
1029492838 7:100881740-100881762 CAGGGTGGCCCCAGGGCTGAGGG - Exonic
1029596661 7:101541307-101541329 AAGTGTGGCAGGAAGGCAGGGGG - Intronic
1030358107 7:108565760-108565782 CAGGGTGGCAGGTGATCAGGTGG - Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032572981 7:133020960-133020982 GAGGGGGGCCGGCGGGCAGCAGG + Intronic
1032706933 7:134428726-134428748 CAGGGTGGGAGGATGGGAGGGGG - Intergenic
1033079653 7:138283319-138283341 CTGGGAGGCCGGGGGGGAGGAGG + Intergenic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033368386 7:140688433-140688455 GAGGGAGGCAGGAGGACAGGAGG + Intronic
1033753698 7:144379896-144379918 CAGGCTGGCTGGAGGGCGTGAGG + Exonic
1034240327 7:149605843-149605865 CAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1034435823 7:151062424-151062446 CTGGGTGGCACGTGGGCAGGGGG - Intronic
1034442850 7:151095810-151095832 TGGGGTGGCAGGGGGGCAGGGGG - Intronic
1035021665 7:155804230-155804252 CAGGCGGGCAGGCGGGCAGGCGG - Intronic
1035051912 7:156003871-156003893 AAGGGTGGGCTGAGGGGAGGCGG + Intergenic
1035334834 7:158121184-158121206 CAGGGAGGCTGGGGTGCAGGGGG - Intronic
1035391600 7:158508148-158508170 CACGGTGGGCAGAAGGCAGGTGG + Intronic
1035468858 7:159097090-159097112 CAGGGTTGCAGGAGGGTTGGCGG + Intronic
1035552982 8:544570-544592 GAGGGTGGGCGGCGCGCAGGTGG - Intronic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035712346 8:1728234-1728256 TAGGGCAGCTGGAGGGCAGGTGG + Intergenic
1036458743 8:8932596-8932618 CAGGGTGGCCAAATGGCAAGTGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037907467 8:22723991-22724013 CAGGCTGGCAGGAAGGCAAGTGG - Intronic
1038261857 8:26002843-26002865 CAGGCAGGCAGGCGGGCAGGCGG + Intronic
1038261860 8:26002851-26002873 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261863 8:26002859-26002881 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261866 8:26002867-26002889 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261876 8:26002895-26002917 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261879 8:26002903-26002925 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038737308 8:30182799-30182821 CAGGGCGGCAGGGGTGCAGGTGG - Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039865704 8:41499632-41499654 CAGGGTGGCTGGATGTCAAGAGG - Intronic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040481458 8:47831445-47831467 CACGGTGCCCCGAGGACAGGTGG - Intronic
1040607419 8:48947921-48947943 CAGGGTGGCAGGAGGAGATGGGG - Intergenic
1040834677 8:51719121-51719143 CCGGGTGGCGGCAGGGCAGAGGG - Intronic
1041677297 8:60548883-60548905 CAGGGTGGCTGCCGGGCAGAGGG + Intronic
1041749585 8:61245799-61245821 AGGGATGGCTGGAGGGCAGGAGG + Intronic
1042134085 8:65617088-65617110 CAGGGTGGCCGCCGGGCAGAGGG - Intronic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1045021844 8:98051637-98051659 CAGGGTGGCGGCTGGGCAGAGGG + Intergenic
1045235852 8:100351634-100351656 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
1045342405 8:101266562-101266584 CAGGGAGGCCCCAGGTCAGGTGG - Intergenic
1045683901 8:104691407-104691429 GAGGGTGGTTGGAGGGCTGGGGG + Intronic
1045831404 8:106465309-106465331 CAAGGTGGCAGGAGGGGTGGAGG + Intronic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048844687 8:138595219-138595241 CAAGGTGGCAGGAGGACAGGTGG + Intronic
1049189706 8:141280219-141280241 CAGGGTGGGCAGGGGGCACGTGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049475367 8:142794694-142794716 GAGGGAGGCAGGAGGGTAGGAGG - Intergenic
1049606681 8:143532848-143532870 CAAGCTGGCCGCAGGGGAGGTGG - Intronic
1049618627 8:143587942-143587964 CAGACTGGCGGCAGGGCAGGAGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1049659179 8:143812093-143812115 CATGCTGGCCGGAGGTGAGGCGG - Intronic
1049684794 8:143934983-143935005 TGGGGGGCCCGGAGGGCAGGGGG - Intronic
1049691838 8:143964992-143965014 CAGGGTGGGCGGGGGGGTGGGGG - Intronic
1049749275 8:144275779-144275801 CAGGTTGGCTGGGGGCCAGGCGG - Intronic
1049782745 8:144436263-144436285 CAGGGTCTCCCCAGGGCAGGCGG - Exonic
1049787779 8:144459305-144459327 GTGGGTGGCAGGAGGGCTGGTGG - Intronic
1049788489 8:144462537-144462559 CGGGGCGGCCGCCGGGCAGGCGG - Intronic
1050181959 9:2932867-2932889 CAGGGATGCCCCAGGGCAGGAGG - Intergenic
1050581443 9:7061636-7061658 CAATGAGGCAGGAGGGCAGGTGG + Intronic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051805632 9:20989982-20990004 CTGGGTGGGGGTAGGGCAGGAGG + Intronic
1052309337 9:27048569-27048591 CAGCGTGGCAGTAAGGCAGGAGG + Intronic
1053407653 9:37891323-37891345 CAGGGTGGCGGCCGGGCAGAGGG - Intronic
1053423333 9:37995128-37995150 CAGGCTGGGGGAAGGGCAGGCGG + Intronic
1053456302 9:38235469-38235491 CATGGTGGCAGCAGGGCAGCTGG + Intergenic
1053807842 9:41821592-41821614 CAGGGAGGCAGGAGGTCAGAGGG - Intergenic
1054622750 9:67365836-67365858 CAGGGAGGCAGGAGGTCAGAGGG + Intergenic
1055511554 9:77000255-77000277 AAGCTTGGCCGGATGGCAGGTGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056643374 9:88388887-88388909 CGGGGAGGCCGGCGGGCAGGGGG + Intronic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1056896825 9:90559093-90559115 GAGGGTGGCTGGGGGTCAGGGGG + Intergenic
1057220696 9:93256330-93256352 CTGGAGGGACGGAGGGCAGGCGG - Exonic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057550889 9:96050200-96050222 CAGAGTCGCCAGATGGCAGGAGG + Intergenic
1057910077 9:99013309-99013331 CTGGGTGACTGGAGGGCAAGTGG - Intronic
1058935764 9:109767907-109767929 CAGGATGGAAGGAGGGAAGGTGG + Intronic
1058976935 9:110133651-110133673 CGGGGTGGGCGGAGGGTAGTGGG - Intronic
1059483894 9:114612418-114612440 CAGGGTGGAGGCAGAGCAGGGGG - Intronic
1059537366 9:115093911-115093933 CATGGTGGTCTGAGGGCAGTGGG + Intronic
1060406697 9:123376415-123376437 CAGGGTGGCAGGGGGGCCGAGGG - Intronic
1060476059 9:123987666-123987688 CAGGGTCGCAGCAGGACAGGTGG - Intergenic
1060530538 9:124344924-124344946 AAGGGTGACTGGAGGCCAGGAGG - Intronic
1060748244 9:126151876-126151898 CAGGGAGGCTGTGGGGCAGGGGG - Intergenic
1061165667 9:128920841-128920863 CAGGCCGTCCGGGGGGCAGGGGG - Intergenic
1061226683 9:129284626-129284648 CAGGGTGGAGGTGGGGCAGGGGG + Intergenic
1061226758 9:129284907-129284929 GGGGGTGGTCTGAGGGCAGGGGG + Intergenic
1061244488 9:129394385-129394407 CAGGGTGCCCGGGAGGCATGAGG + Intergenic
1061295655 9:129675491-129675513 GAGGGTAGCAGGGGGGCAGGAGG - Intronic
1061371012 9:130197600-130197622 CTGGCTGGCGGGAGGGCTGGGGG + Intronic
1061588706 9:131584433-131584455 CCGTGAGGCAGGAGGGCAGGCGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061798354 9:133101338-133101360 AAGGCTGGCCTGAGGGCAGAGGG - Intronic
1061828234 9:133274991-133275013 CTGGGGAGCCGGCGGGCAGGTGG - Intronic
1062003006 9:134226206-134226228 CAGGGGGGCTGGGAGGCAGGGGG + Intergenic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062207387 9:135344716-135344738 CAGGGTGGCTGCAGGGCTGTGGG + Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062238532 9:135524026-135524048 GAGGGAGGAGGGAGGGCAGGTGG - Intronic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062290021 9:135790254-135790276 TGGGGTGGCCGCATGGCAGGTGG - Intronic
1062326812 9:136016493-136016515 CAGGGAGCATGGAGGGCAGGCGG - Intronic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380744 9:136285460-136285482 CAGGCGGGCAGGTGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062531122 9:137000868-137000890 TTGGGGGGCCGGAGGGCTGGGGG + Intergenic
1062532303 9:137007292-137007314 CAGGGAGGTGGGCGGGCAGGGGG + Exonic
1062599440 9:137313335-137313357 CAGGGTGGCCGGCAGGCAGGAGG - Intronic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1203427089 Un_GL000195v1:51204-51226 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1203439113 Un_GL000195v1:171861-171883 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1186466263 X:9786391-9786413 GAGGGAGCCCGGAGGGCTGGCGG - Intergenic
1186554311 X:10541333-10541355 GGGGGTGGTGGGAGGGCAGGGGG - Intronic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1187571025 X:20502301-20502323 CTGGGTGGGCTGAGGGGAGGTGG - Intergenic
1190128425 X:47725275-47725297 AGGGATGGCTGGAGGGCAGGTGG - Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190505029 X:51119111-51119133 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
1192215750 X:69156961-69156983 GAGGGTGGCAGGAGGGGAAGGGG + Intergenic
1192491533 X:71579981-71580003 CAGAGTGGCGGGAGGTAAGGGGG + Intronic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1194421150 X:93673923-93673945 CAGGGTGGGCGGATGGGAGAAGG - Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195364269 X:104112400-104112422 CCGGCTGGCCGGCGGGCCGGCGG - Intronic
1195548181 X:106137354-106137376 GAAGGTGGCTGGAGGGCAGGTGG - Intergenic
1195968262 X:110448685-110448707 CAGGCTGGCTGGCGGGCAGGGGG + Intronic
1196711733 X:118770240-118770262 CAGGGTGCACGATGGGCAGGCGG - Intronic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1198453712 X:136794235-136794257 CAGGGTAGCAGCAGGGGAGGAGG - Intergenic
1199086501 X:143635021-143635043 CAGGCGGGCCGGCGGGCAGGCGG + Intronic
1199099758 X:143785193-143785215 CAGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199767941 X:150954144-150954166 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200090645 X:153634314-153634336 AAGGGTGGAGGGAGCGCAGGGGG + Intergenic
1200137585 X:153882584-153882606 CTGCCTGGCTGGAGGGCAGGGGG + Intronic
1201624949 Y:16004559-16004581 CAGGGAGGCTGGCAGGCAGGTGG + Intergenic
1202195292 Y:22294595-22294617 GAGGGTGTCCTGAGGGCACGTGG + Intergenic