ID: 912680626

View in Genome Browser
Species Human (GRCh38)
Location 1:111726830-111726852
Sequence GGCTTCTCCCCGCTTTCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 236}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912680611_912680626 30 Left 912680611 1:111726777-111726799 CCCAAGACAGCCTCTCCCAACCA 0: 1
1: 0
2: 3
3: 20
4: 260
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680616_912680626 10 Left 912680616 1:111726797-111726819 CCACCTTCCCTTCAGTCCTGAGC 0: 1
1: 0
2: 2
3: 37
4: 445
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680613_912680626 20 Left 912680613 1:111726787-111726809 CCTCTCCCAACCACCTTCCCTTC 0: 1
1: 2
2: 11
3: 137
4: 1482
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680617_912680626 7 Left 912680617 1:111726800-111726822 CCTTCCCTTCAGTCCTGAGCCAA 0: 1
1: 0
2: 2
3: 30
4: 263
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680615_912680626 14 Left 912680615 1:111726793-111726815 CCAACCACCTTCCCTTCAGTCCT 0: 1
1: 0
2: 4
3: 55
4: 806
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680619_912680626 2 Left 912680619 1:111726805-111726827 CCTTCAGTCCTGAGCCAAGAACT 0: 1
1: 0
2: 1
3: 12
4: 174
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680618_912680626 3 Left 912680618 1:111726804-111726826 CCCTTCAGTCCTGAGCCAAGAAC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680612_912680626 29 Left 912680612 1:111726778-111726800 CCAAGACAGCCTCTCCCAACCAC 0: 1
1: 1
2: 3
3: 33
4: 348
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680621_912680626 -6 Left 912680621 1:111726813-111726835 CCTGAGCCAAGAACTCTGGCTTC 0: 1
1: 0
2: 1
3: 28
4: 266
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236
912680614_912680626 15 Left 912680614 1:111726792-111726814 CCCAACCACCTTCCCTTCAGTCC 0: 1
1: 0
2: 1
3: 42
4: 344
Right 912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG 0: 1
1: 0
2: 3
3: 11
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912680626 Original CRISPR GGCTTCTCCCCGCTTTCTGG GGG Exonic
900641526 1:3690083-3690105 GGCTTGTCCCTGTTTCCTGGGGG + Intronic
900965129 1:5952475-5952497 GTCTTTTCCCCTCTTTCTGGAGG - Intronic
900973437 1:6004030-6004052 GGCTCCTCCCTGCTCTCCGGGGG - Intronic
902619679 1:17643670-17643692 GCATTTTCCCCGTTTTCTGGTGG - Intronic
902636591 1:17738799-17738821 TGTTTCTCTCCACTTTCTGGGGG - Intergenic
902999595 1:20255571-20255593 GGGTTCTGCCTTCTTTCTGGAGG - Intergenic
903795814 1:25928112-25928134 GGCTTCTCCCTGCTGTCCGCTGG + Intergenic
905402822 1:37715899-37715921 GGCTTCTGCCCCCTTCCTCGAGG - Intronic
905653028 1:39669066-39669088 GGCTTCTTTCTGCTCTCTGGAGG - Intronic
906147511 1:43568807-43568829 GCCTTCTCCCAGCTTGCTAGGGG - Intronic
907220360 1:52903062-52903084 GGCTTCTCCCAACTCTCAGGGGG - Intronic
908601419 1:65744179-65744201 GGCTTCAGCCCCCTTTCCGGAGG + Intergenic
909403276 1:75258201-75258223 GGCTTCAGCCCCCTTTCTAGGGG - Intronic
909690157 1:78398206-78398228 GGCTTCAGCCCCCTTTCCGGGGG + Intronic
910805751 1:91188618-91188640 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
912582271 1:110731259-110731281 GGCTTCTTCCTAGTTTCTGGTGG - Intergenic
912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG + Exonic
914808491 1:151008907-151008929 GACTTCTCCCCGCTCTCAGGCGG - Intronic
915568677 1:156731969-156731991 GGCTTCTCCCCTTCTTCTGTAGG + Exonic
916256588 1:162793862-162793884 GGCTTCTCCCTGCTTCCTAAGGG + Intronic
916878744 1:168998551-168998573 GGCTTCAGCCCGCTTTCCAGGGG + Intergenic
919513718 1:198495885-198495907 GGCTTCTCCAGGCTTTCATGTGG - Intergenic
919598969 1:199599627-199599649 GGCTTCAGCCCCCTTTCTGGGGG - Intergenic
920253006 1:204634654-204634676 TGCCTCTTCCTGCTTTCTGGTGG - Intronic
920378761 1:205523539-205523561 GGCTCCTCCCCGCTGTCTGTTGG - Exonic
921585007 1:216935978-216936000 AGCTTCTCTCCCCTTCCTGGAGG + Intronic
921925975 1:220710427-220710449 GCCTTCTCCCCACTTCCTGTAGG + Intergenic
922066189 1:222145934-222145956 GGCTTCTGCCCCCTTTCCAGGGG - Intergenic
922701323 1:227762790-227762812 GGCTTCTGACAGCCTTCTGGAGG + Intronic
924531167 1:244895098-244895120 GGGTTATCCCCTCATTCTGGTGG + Intergenic
1063192937 10:3714964-3714986 TTCTTCCCCCCACTTTCTGGTGG - Intergenic
1064217194 10:13410181-13410203 GGCTTCTCTCCTCTTTAGGGAGG + Intergenic
1064263989 10:13809672-13809694 TGCTCCTCCCAGCTTTCTTGAGG + Intronic
1064970296 10:21059131-21059153 GGCTTCACCCCGACTGCTGGGGG - Intronic
1066509921 10:36084141-36084163 GCATTCTCCCCCCTTCCTGGGGG + Intergenic
1067295829 10:44974783-44974805 GCCTTCTCCCCGCTTCCGAGGGG + Intronic
1067718371 10:48707326-48707348 GCCTGATGCCCGCTTTCTGGAGG + Intronic
1069403483 10:68074830-68074852 GCTTTCTCCGCGCTTCCTGGGGG - Intronic
1069714823 10:70513981-70514003 GGCTTCCCCCTGCTCTCTGAGGG + Intronic
1069876898 10:71568605-71568627 GGCTTCTCCCTTGCTTCTGGAGG + Intronic
1070632452 10:78096531-78096553 GGCTTCAGCCCCCTTTCCGGGGG - Intergenic
1070952671 10:80443671-80443693 GGCTCCTCCCTGCCTTCTGCCGG - Intergenic
1071366804 10:84908272-84908294 GGCTTCTTCCAGCCTTCTTGGGG + Intergenic
1071895610 10:90063317-90063339 GGCTTCTCTCTACTTGCTGGTGG - Intergenic
1072876158 10:99175282-99175304 GGTTTCAGCCCCCTTTCTGGGGG - Intronic
1074571331 10:114626940-114626962 TGCTTCTCCCTGGCTTCTGGAGG - Intronic
1074795532 10:116939145-116939167 GGCTTCTGCCCCCTTTCCAGGGG + Intronic
1076411144 10:130251929-130251951 TGCCTCTCCACGGTTTCTGGTGG + Intergenic
1076590561 10:131579616-131579638 GACTACGCCTCGCTTTCTGGAGG + Intergenic
1077546302 11:3171651-3171673 TGCTTCTCCCCAGTTTCTGGTGG + Intergenic
1077628842 11:3797338-3797360 GGTTTCTCCCCCCTTCCGGGCGG - Intronic
1079128625 11:17735257-17735279 TCCTTCTCCCCGCCTCCTGGAGG - Exonic
1079510599 11:21205593-21205615 GGCTTCAGCCCCCTTTCTAGTGG + Intronic
1081050316 11:38332019-38332041 GGCTTTTCCCCGTTTTCCTGAGG + Intergenic
1083619004 11:64039787-64039809 GGCCTCTCCTTGCTTTGTGGAGG + Intronic
1084863865 11:72040330-72040352 CCCTTCTCCCCGTTCTCTGGAGG + Intronic
1085396180 11:76208285-76208307 GGCTTCTCCTCGCCTTCCTGTGG - Intronic
1087328698 11:96753616-96753638 GGATTCTGCCCCCTTTCTGCAGG + Intergenic
1087596103 11:100256962-100256984 GGCTTCAGCCCCCTTTCTAGGGG - Intronic
1088017729 11:105081276-105081298 TGCTTCTCCTTGCTTTCTGTAGG - Intronic
1088294497 11:108277345-108277367 GGCTTCAGCCCCCTTTCTAGGGG + Intronic
1088307243 11:108423243-108423265 GGCTTCAGCCCCCTTTCTAGGGG - Intronic
1089077333 11:115748713-115748735 GGCTTCTCAGTGGTTTCTGGCGG + Intergenic
1091173441 11:133538843-133538865 TGCTTCTCCCTTGTTTCTGGAGG + Intergenic
1098103691 12:67046206-67046228 GGCTTCTGCCCGCTTCATAGGGG - Intergenic
1099238950 12:80116029-80116051 GGCTTCTGCCCCCTTTCCAGGGG + Intergenic
1102520726 12:113476366-113476388 GGCTGAGCCCCGCTGTCTGGAGG + Intergenic
1104846996 12:131851756-131851778 GACCTCTCCCTGCTTTCTAGCGG + Exonic
1107314848 13:39119974-39119996 GGCTTCTGCCCCCTTTCCGGGGG + Intergenic
1107664360 13:42673752-42673774 TGCTTCTCCCTGCTCCCTGGGGG - Intergenic
1108235022 13:48394413-48394435 GGCTTCAGCCCCCTTTCCGGGGG - Intronic
1111946285 13:94669026-94669048 GGCTTCTCTCCTGCTTCTGGTGG - Intergenic
1112341549 13:98556713-98556735 GGCTTCTACCCGATTTTTGCAGG + Intronic
1113179353 13:107608192-107608214 AGCTTCTCCCAGCTCTCTTGTGG + Intronic
1113465831 13:110512394-110512416 GGCTGCTCCTGGCTTTCTGTGGG - Exonic
1113709289 13:112453254-112453276 GGCTTCTCTCCGTTTTCTCGGGG - Intergenic
1115472840 14:33785996-33786018 GGCTTCTCCCTGCTGTGGGGTGG - Intronic
1115856286 14:37633102-37633124 GGCTTCAGCCCCCTTTCTAGGGG + Intronic
1117813732 14:59576474-59576496 GCCTTCTCCCCGCTCCTTGGAGG - Intronic
1118604313 14:67491864-67491886 GGCCTCTCCTTGCTTCCTGGGGG - Intronic
1118809596 14:69263176-69263198 GGATTCTCACCCATTTCTGGGGG + Intronic
1121876523 14:97458129-97458151 GGGTCTTCCCCGCTTCCTGGTGG + Intergenic
1122351967 14:101101540-101101562 GGCTTCTCTCCAGCTTCTGGTGG - Intergenic
1125486191 15:40112469-40112491 GGCTCCTGCCCGCTTTCTACAGG - Intergenic
1126187195 15:45841788-45841810 AGCTTCTCTCCCCTTTCTAGAGG + Intergenic
1126500572 15:49340096-49340118 GGCTTCTGCCCCCTTTCCAGGGG + Intronic
1127631559 15:60832465-60832487 GGCTTCTCCTGTCTTTCTTGGGG - Intronic
1127775896 15:62264142-62264164 AGCCTCTCCCCGCTCTCTGTAGG + Intergenic
1130205263 15:81869712-81869734 GTCTTCTTCCAGCTTTCTGCTGG - Intergenic
1130657213 15:85800084-85800106 GACTTATCCCTGCTTTCTGAGGG + Intergenic
1131922251 15:97341080-97341102 GATTTCTCCCCACTTTCTGTTGG + Intergenic
1132082185 15:98875769-98875791 GGCTTCTCCTCTCTTCCTGCTGG - Intronic
1132668825 16:1094536-1094558 GGCTTCTTCCTGCTTGCGGGGGG + Intronic
1135603168 16:23800731-23800753 TGCTTCTTCCCAGTTTCTGGTGG - Intergenic
1136784263 16:32925425-32925447 GGCCGCTGCCCGCTTTCTGCAGG - Intergenic
1136885521 16:33928381-33928403 GGCCGCTGCCCGCTTTCTGCAGG + Intergenic
1138082182 16:54100932-54100954 GGCATCTCCACGCTTTCTTCAGG - Intronic
1138122259 16:54410130-54410152 GGCTTCCCCGCGCCTCCTGGAGG - Intergenic
1141687772 16:85580099-85580121 GGCCTCTTCTCTCTTTCTGGGGG + Intergenic
1203086920 16_KI270728v1_random:1189431-1189453 GGCCGCTGCCCGCTTTCTGCAGG - Intergenic
1142854958 17:2724286-2724308 CGCCTCGCCCCGCTTCCTGGAGG + Intergenic
1143789816 17:9285539-9285561 GGCTTCACCCTGGCTTCTGGAGG - Intronic
1144434143 17:15224081-15224103 GGCTTCAGCCCCTTTTCTGGGGG + Intergenic
1144767058 17:17738558-17738580 GGCTTCTCCCAGTTTCCTGCTGG - Intronic
1147144552 17:38477572-38477594 GGCCGCTGCCCGCTTTCTGCAGG - Exonic
1148450505 17:47774714-47774736 GCCATCTTCCCGCCTTCTGGAGG + Intergenic
1151703031 17:75753486-75753508 GACTTCCCCCAGGTTTCTGGCGG + Intronic
1152761124 17:82107506-82107528 GGCCTCTTCCTCCTTTCTGGCGG - Intronic
1152916617 17:83040044-83040066 GGCATCACCCCACTTTCTAGTGG - Intronic
1155199219 18:23503165-23503187 GGCTCCTCCTTGCTTTCGGGAGG - Intergenic
1157100674 18:44725982-44726004 GGCATCTCCTGGCTCTCTGGTGG + Intronic
1157614331 18:48977798-48977820 GGCTTCGGCCAGCTTTCTTGGGG - Intergenic
1157810532 18:50692272-50692294 GGCCTCTCTCCGCGCTCTGGAGG + Intronic
1159861567 18:73655121-73655143 TGCTTCTCCCTTCTCTCTGGGGG - Intergenic
1160019243 18:75167716-75167738 GGCTGCTCCCCGCATACCGGTGG + Intergenic
1160622459 18:80180623-80180645 GGCTGCTCCCCACTCCCTGGAGG + Intronic
1160884904 19:1341304-1341326 GGCCTCTCCACGCCTCCTGGAGG + Intergenic
1160957633 19:1700702-1700724 GGCTTCTCTCCTCTTGCTGTGGG + Intergenic
1160975318 19:1790029-1790051 GGCTTCTCCCCACTTCCCCGGGG + Intronic
1161957131 19:7502450-7502472 GGCCTCTACCCGCTGTCTGCTGG - Intronic
1162148444 19:8628261-8628283 TGCTTCTCCCTGGCTTCTGGTGG + Intergenic
1162538170 19:11276711-11276733 GGCTGCCCCCCACCTTCTGGAGG + Intergenic
1162925902 19:13930416-13930438 GCCTGCTGCCCGCTTTCTGGGGG - Exonic
1163386065 19:17001405-17001427 GGCTGCTCCCCGCCCTCTGCAGG - Intronic
1163400515 19:17089452-17089474 GGCTACGCCACACTTTCTGGAGG + Intronic
1163548292 19:17951858-17951880 GGCTGCTCCCCTCACTCTGGGGG - Intronic
1163669799 19:18620745-18620767 TCCTTGTCCCCGCTTTCTTGGGG + Exonic
1166882855 19:45939859-45939881 GGCCTCATCCCACTTTCTGGGGG + Exonic
1168270420 19:55246889-55246911 CGCTCCTCACCGCTATCTGGCGG + Exonic
925749017 2:7070792-7070814 GGCTTCTCCCTAGCTTCTGGTGG - Intergenic
927874894 2:26648692-26648714 GGCTTCTCAGCACGTTCTGGTGG + Intergenic
929992789 2:46803793-46803815 GGTTCCTCCCCGCTTGCTTGTGG + Intergenic
931906512 2:66849141-66849163 GGCTTCTTCAGGCTTTCAGGAGG + Intergenic
932261794 2:70333118-70333140 GGATGCTCCCACCTTTCTGGTGG + Intergenic
932451477 2:71813406-71813428 GGCAGCTCCCCTCATTCTGGTGG + Intergenic
934621365 2:95810481-95810503 GGCTTCTTCTCACTTTCTGTGGG - Intergenic
937272032 2:120659147-120659169 TGCTTCTGGCCCCTTTCTGGTGG + Intergenic
938009253 2:127815537-127815559 GCTTTCTCCCCCCTTTCTAGAGG + Intergenic
943074668 2:183179531-183179553 GGCTTCAGCCCCCTTTCCGGGGG + Intergenic
943599155 2:189893198-189893220 GGCTTCAGCCCCCTTTCCGGAGG + Intronic
944347357 2:198684932-198684954 GGCTTCAGCCCCTTTTCTGGGGG - Intergenic
944607901 2:201369776-201369798 GGCTTCAGCCCGCTTTCCAGAGG - Intergenic
945028001 2:205637646-205637668 GGCTTCTCCCCTCTCTGTAGTGG + Intergenic
946016145 2:216605679-216605701 GGCTTCTCCCCTCCTTCTGGTGG - Intergenic
946253634 2:218428405-218428427 GGCCTCTCCCCGCTGACTGCTGG + Intronic
948570684 2:238915375-238915397 GGATTCTCCCAGAGTTCTGGGGG - Intergenic
948709497 2:239817076-239817098 GGCTTCTCCCCGGTTTCTGAAGG + Intergenic
1168923259 20:1558498-1558520 TGCTTCCTCCCTCTTTCTGGGGG - Exonic
1171091385 20:22288638-22288660 GGCTTCTCCCCTAGTACTGGAGG - Intergenic
1171724726 20:28605863-28605885 GTATTCTCCCAGTTTTCTGGTGG + Intergenic
1173340190 20:42146329-42146351 GGCTTCACCCCACTTTCAGGGGG - Intronic
1175056661 20:56204756-56204778 GGCTTCTACCTGCTTTTAGGAGG + Intergenic
1175363469 20:58433452-58433474 GGCTTCTACCACCTTTCTGCTGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175451487 20:59072491-59072513 GGATTCTCCCCTAGTTCTGGAGG - Intergenic
1175564502 20:59962395-59962417 GGCCTCTCCCCAGCTTCTGGTGG + Intronic
1176369620 21:6054462-6054484 GGCTTCTCGCTGTTTTATGGCGG + Intergenic
1177881339 21:26698591-26698613 GGCTTCTTGCTGCTCTCTGGAGG + Intergenic
1179753899 21:43484079-43484101 GGCTTCTCGCTGTTTTATGGCGG - Intergenic
1179973002 21:44846751-44846773 GGCTTCTCCCCATCTGCTGGAGG + Intergenic
1180839804 22:18954083-18954105 GGCCTCTCCCCGAGCTCTGGCGG + Intergenic
1180983798 22:19892353-19892375 GGCTTCTGCGCGCCTGCTGGGGG - Intronic
1181062091 22:20286396-20286418 GGCCTCTCCCCGAGCTCTGGCGG - Intergenic
1183332462 22:37228866-37228888 GGCGTCTCCCCTCTACCTGGAGG + Intronic
1183841922 22:40505675-40505697 GGCTTCACACAGCTTTCGGGTGG + Intronic
1184135890 22:42549725-42549747 TGCTTCTCACCGCCTGCTGGAGG - Intergenic
1184366035 22:44051961-44051983 GGCCTCTTCCCAGTTTCTGGTGG - Intronic
951250761 3:20391758-20391780 GGCTTCTTCCCATTTTCTGGTGG + Intergenic
951611057 3:24494063-24494085 GGCTTCTCTCCGCCTCCTGGGGG - Intronic
953203172 3:40796010-40796032 GGTTTCTCCAAGCTTTCTTGTGG + Intergenic
954431659 3:50473938-50473960 GGCTTCTCCTGGCACTCTGGTGG - Intronic
954686820 3:52375491-52375513 GGCCACTCCACCCTTTCTGGTGG - Intronic
956383085 3:68686435-68686457 GGCTTCAGCCCCCTTTCCGGGGG + Intergenic
957461394 3:80525787-80525809 TGCTTCTGCCTGTTTTCTGGAGG + Intergenic
960265394 3:115615485-115615507 GGATTCACCCTGCTTTCTGTAGG - Intergenic
961652204 3:128422242-128422264 GCCTGCGCCCAGCTTTCTGGAGG - Intergenic
962668370 3:137679506-137679528 GGCTTCAGCCCCCTTTCCGGGGG - Intergenic
968253892 3:197247873-197247895 GGCTTAACCCCACTTACTGGAGG + Intronic
968898400 4:3418592-3418614 GGCTGCTCCCCGCCTGCAGGGGG + Intronic
973309341 4:48691005-48691027 GGCTTCTCTAAGCTTGCTGGAGG - Intronic
975149440 4:71004961-71004983 GGCTTCAGCCCCCTTTCTAGGGG + Intronic
975177888 4:71308890-71308912 GGCTTCAGCCCCCTTTCTAGGGG - Intronic
975764660 4:77654906-77654928 GGCTTCAGCCCGCTTTCCAGGGG - Intergenic
978310437 4:107380650-107380672 GTCTACCCCCCTCTTTCTGGAGG - Intergenic
978617734 4:110612912-110612934 AGCTGCCCACCGCTTTCTGGGGG + Intergenic
981411234 4:144435089-144435111 GGCTTCAGCCCTCTTTCTAGGGG - Intergenic
981443453 4:144809041-144809063 GGCTTCTGCCCCCTTTCCAGGGG - Intergenic
985210422 4:187586716-187586738 GACTGCTCCCCGCTTCCTGCTGG + Intergenic
985543814 5:499407-499429 GGGGCCACCCCGCTTTCTGGGGG + Intronic
985851350 5:2391085-2391107 GGCATCTCACCGGGTTCTGGGGG + Intergenic
988970764 5:36465395-36465417 GGCTTCACCCCTCTTTCCAGGGG - Intergenic
992254902 5:74911746-74911768 GGCTTCTGCCCCCTTTCCAGGGG + Intergenic
997217868 5:132129398-132129420 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
997252263 5:132398287-132398309 GGCTTCAGCCCCCTTTCCGGGGG - Intergenic
1001075104 5:168620684-168620706 AGGTCCTCCCCTCTTTCTGGAGG + Intergenic
1001420964 5:171586833-171586855 GGACTCTCCTTGCTTTCTGGGGG + Intergenic
1003713531 6:8619792-8619814 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1006725783 6:36197817-36197839 AGTTTCTCCCCGGTGTCTGGAGG + Intronic
1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG + Intronic
1008425242 6:51349286-51349308 GGCTTCAGCTCCCTTTCTGGGGG + Intergenic
1009198734 6:60718994-60719016 GGCTTCTCCCATTTTTCAGGGGG + Intergenic
1011137428 6:84115554-84115576 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1011776807 6:90739718-90739740 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1012024691 6:93973639-93973661 TGCCTCTCCCCGGCTTCTGGTGG - Intergenic
1012818350 6:104053631-104053653 GGCTTTTCCCCCCTTTTTGCTGG - Intergenic
1013826361 6:114215548-114215570 GGATTCTCCTGGCTTCCTGGGGG - Intronic
1014753677 6:125280399-125280421 GGCTTCAGCCCCCTTTCTAGGGG - Intronic
1017723201 6:157258740-157258762 GGGTTTTCCCAGCTTCCTGGTGG + Intergenic
1017888476 6:158620381-158620403 GCCTTCTCCTGGCTTTCTCGTGG - Intronic
1018011860 6:159678015-159678037 AGCCTCTCTCCCCTTTCTGGAGG - Exonic
1020006560 7:4786480-4786502 GGCTCCTCCCCTCTTTCCAGCGG + Intronic
1020095716 7:5367876-5367898 GGCTTCTCCAGGCTTCCTTGAGG + Intronic
1022814909 7:33904878-33904900 GGCTCCTCCTCCCTTTCTTGGGG - Intergenic
1023056884 7:36298051-36298073 TGCTTCTCCCCTCTCTCTTGGGG + Intronic
1028476354 7:91257855-91257877 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1028652869 7:93170390-93170412 GGCTTCAGCCCTCTTTCTAGGGG + Intergenic
1030958830 7:115889310-115889332 GGCTTCAGCCCCCTTTCCGGGGG - Intergenic
1034370799 7:150594722-150594744 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1035175305 7:157045865-157045887 GGCTTCTCCCTGTTTCATGGGGG + Intergenic
1035525728 8:311607-311629 GGCTTCTCAGCCCTTTCTGTGGG + Intergenic
1037679953 8:21088983-21089005 GGATTCTCCCCAATTTCTGCAGG + Intergenic
1040473878 8:47760103-47760125 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1040779873 8:51095133-51095155 GGCTTCAGCCCACTTTCTAGGGG - Intergenic
1044034694 8:87285967-87285989 GGCTTATGCCAGCTTTCTGCAGG - Intronic
1044312397 8:90709015-90709037 GGCTTCAGCCCTCTTTCTAGGGG + Intronic
1045783658 8:105897134-105897156 GGCTTCTGCCCCCTTTCCAGGGG - Intergenic
1047894311 8:129349200-129349222 GGCATCTACTCACTTTCTGGTGG + Intergenic
1050292948 9:4175712-4175734 GCCTTCTCCCAGCGTTATGGTGG - Intronic
1056551631 9:87657912-87657934 GGCTCCTTCCTCCTTTCTGGTGG + Intronic
1056795703 9:89657338-89657360 GGCTTCTCCCCGGAGACTGGAGG - Intergenic
1056945849 9:90995972-90995994 GGCTTCTCCCCTCATTATGTGGG + Intergenic
1057551001 9:96050831-96050853 GGGTTCTCCCCGCTCTCTGGAGG + Intergenic
1060194726 9:121616256-121616278 GCCTTCTCCTGCCTTTCTGGGGG + Intronic
1061306950 9:129737797-129737819 GGCCTCACGGCGCTTTCTGGCGG + Intergenic
1062662765 9:137647480-137647502 TTCTTCTCCCTGCTTTTTGGTGG + Intronic
1186514789 X:10158782-10158804 GGCCCCTGCCCGCTTTCTCGGGG - Intronic
1188099984 X:26071565-26071587 GGCTTCTGCCCCCTTCCTAGGGG + Intergenic
1189386924 X:40544777-40544799 GGCTGCCCCGTGCTTTCTGGGGG - Intergenic
1192755838 X:74046498-74046520 GGCTTCAGCCCCCTTTCTAGGGG + Intergenic
1192784526 X:74323431-74323453 GGCTTCCCTCACCTTTCTGGAGG + Intergenic
1192804106 X:74494888-74494910 GGCTTCCCTCACCTTTCTGGAGG - Intronic
1193639967 X:84001032-84001054 TGCTTTTCCCGCCTTTCTGGAGG - Intergenic
1195063536 X:101219201-101219223 GGCTTCTCCCAGGTCTCTGAGGG + Intergenic
1196520337 X:116664180-116664202 GCCTGCTCCCCTCTTTCTAGAGG - Intergenic
1196985898 X:121270456-121270478 GTCTTTTCCCCGCTTTTTGATGG - Intergenic
1197378238 X:125709158-125709180 GGCTGCTGCCTGCTTTGTGGGGG - Intergenic
1197906226 X:131428425-131428447 GGCTTCAGCCCCCTTTCCGGGGG - Intergenic
1198036672 X:132807874-132807896 AGTTTCTCCCAGCCTTCTGGAGG - Intronic
1199924588 X:152449578-152449600 GGCTTCACCTGGATTTCTGGAGG - Intronic
1200076250 X:153552702-153552724 GGATTCTCCCCCAGTTCTGGAGG + Intronic
1202039839 Y:20669869-20669891 GGCTTGTCCCCTATTTCTGTAGG + Intergenic