ID: 912681900

View in Genome Browser
Species Human (GRCh38)
Location 1:111734129-111734151
Sequence CTGTGCCAAGAGCTGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912681893_912681900 22 Left 912681893 1:111734084-111734106 CCCTCACACTTGGCTGGAACTCT No data
Right 912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 208
912681894_912681900 21 Left 912681894 1:111734085-111734107 CCTCACACTTGGCTGGAACTCTC No data
Right 912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 208
912681892_912681900 23 Left 912681892 1:111734083-111734105 CCCCTCACACTTGGCTGGAACTC No data
Right 912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912681900 Original CRISPR CTGTGCCAAGAGCTGTAGGA GGG Intronic
900472498 1:2861709-2861731 CTGTGCCAAGGGCTCTGGAATGG - Intergenic
901160238 1:7171774-7171796 GCCTGCCAGGAGCTGTAGGAGGG - Intronic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
903439551 1:23377320-23377342 CCTTGCCAAGAGCAGTAGGGGGG + Intergenic
904838024 1:33351621-33351643 CTGTGCAAAGCACTGTGGGAAGG - Intronic
905953451 1:41972475-41972497 CTGGGCTATGAGCTCTAGGAGGG - Intronic
906868238 1:49446956-49446978 CTGTGCCCAGGGATGAAGGATGG - Intronic
906949623 1:50323668-50323690 CTGTGCCTGGTGCTGTAGGGAGG - Intergenic
908985045 1:70007283-70007305 CTGTGCCAAGAACTGGATGAAGG + Intronic
912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG + Intronic
913229968 1:116733650-116733672 ATGTGGCAAGAGCTGTGGGCTGG - Intergenic
914377023 1:147080598-147080620 CTGTGCCAAGAGAAGCAGCAAGG - Intergenic
914474712 1:148013700-148013722 CTGTGCCAAGAGAAGCAGCAAGG + Intergenic
914998617 1:152566297-152566319 CTGAGGCAAGAGCTGCAAGAGGG + Intronic
914999971 1:152580025-152580047 CTGAGGCAAGAGCTGCAGGAAGG + Intronic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
920818245 1:209355647-209355669 CTGTTCCAAGAGCTGTGCAAGGG - Intergenic
923862801 1:237908483-237908505 CAGTACCAAGAGTTGAAGGAAGG + Intergenic
1069720181 10:70544803-70544825 CTGTGCCCAGGGGAGTAGGAGGG - Intronic
1069750442 10:70741963-70741985 CTGGGCCAAGAGTTGTGTGATGG - Intronic
1075483854 10:122804522-122804544 CTCTGACAAGACCTGTAGTAAGG + Intergenic
1075511328 10:123074820-123074842 CTATGCCAAGTGCTGGGGGACGG - Intergenic
1075642134 10:124072428-124072450 CTGTGCCAAAAGCTGTTGTTTGG - Intronic
1077741615 11:4852418-4852440 CTGTGTGAAGAACTGTAGGCTGG + Intronic
1078746543 11:14120783-14120805 CTGTGCTAAGGGCTGTAATATGG + Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1081662962 11:44899624-44899646 ATGTGTCAAGTGCTGTATGAGGG + Intronic
1084410189 11:69002381-69002403 CTTTTCCCAGAGCTGTGGGATGG + Intergenic
1084502182 11:69541314-69541336 AAGTACCAACAGCTGTAGGAAGG + Intergenic
1084669230 11:70595553-70595575 CTGTGACAGGGGCTGTAGGCTGG - Intronic
1084705854 11:70815659-70815681 CTGGGCTCAGAGCTGTAGGCAGG - Intronic
1085389275 11:76174311-76174333 GTGTGCCCAGGGCTGAAGGAGGG + Intergenic
1085694381 11:78691441-78691463 TTGTGCCAAGTCCTGTAGGAGGG - Intronic
1088611555 11:111582281-111582303 CTGAGCACAGATCTGTAGGAAGG + Intergenic
1089064420 11:115651628-115651650 ATTTGCCAGGAGCTGGAGGAAGG - Intergenic
1089863910 11:121615309-121615331 ATGTGCCAAGAGCCTTGGGACGG - Intronic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1094808034 12:34109527-34109549 CTGTACCAGGAGCTGCAGGGTGG - Intergenic
1095554580 12:43485007-43485029 CTGTTCCAAAAGATGGAGGAGGG + Intronic
1096477987 12:51920347-51920369 CTTTGCCAAGATCCATAGGAAGG - Intronic
1096582229 12:52593020-52593042 CTGTGCTGAGAGCTGCAGGGTGG + Intronic
1097403716 12:59162280-59162302 CTGTGGCAAGAACAGTATGAGGG - Intergenic
1098051737 12:66461505-66461527 CAATGCAAACAGCTGTAGGAAGG - Intronic
1098231347 12:68374802-68374824 CTGTCCCCAGAGCTGTAGTTTGG - Intergenic
1099256886 12:80325414-80325436 CTGTGCCAAGTGCTGTAAAATGG + Intronic
1100011201 12:89955565-89955587 GTGTGCCAAGAACTGGGGGAAGG - Intergenic
1101272674 12:103164074-103164096 CTGTGCTAAGATCTGTAAAATGG + Intronic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1108468036 13:50738509-50738531 ATGTACCAAAAGCAGTAGGAGGG - Intronic
1113665184 13:112136397-112136419 TTGAGCCAAGACCTGGAGGAAGG - Intergenic
1114470511 14:22957819-22957841 CTGTCCCAATAGCTCTCGGAAGG + Intronic
1119428907 14:74552958-74552980 CTGTGCCAACAGCTGTGAGAGGG - Exonic
1121036157 14:90705411-90705433 CTGGCCCAACAGCTCTAGGAGGG + Intronic
1121549466 14:94787814-94787836 CTCTTCAAAGAGGTGTAGGAAGG - Intergenic
1121830774 14:97050221-97050243 CTGTTCCAAAAGGTGTAGGCTGG - Intergenic
1122307368 14:100774235-100774257 CTGCCCCAGGAGCTGTTGGAAGG + Intergenic
1127059114 15:55163993-55164015 CAGTGACAAGAGCTGTAACAGGG - Intergenic
1130288189 15:82572568-82572590 CTGTGCCTACAGTTGCAGGAGGG - Intronic
1130767316 15:86884109-86884131 ATGTGCCAAGAGTAGTAGTAAGG - Intronic
1131020045 15:89089662-89089684 CTGTGCCCAGAGCTTTTCGAAGG + Intronic
1133076060 16:3282350-3282372 CAGTGCCACCACCTGTAGGAAGG + Intronic
1133829663 16:9310046-9310068 CTGTGACACGTGCTGAAGGAGGG - Intergenic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1138496291 16:57411290-57411312 CTGTGCCCAGGGCTGCAGGGCGG - Intronic
1138497888 16:57419327-57419349 CAGTGCCAAGAGCTGTGGGCTGG + Intergenic
1138549100 16:57737564-57737586 CTGTGCTAAGTGCTTTAGGATGG - Intronic
1139768919 16:69256490-69256512 AAGTGCCAGGAGCTGAAGGAAGG - Intronic
1139917589 16:70438226-70438248 CTCAGCCCAGAGCTGTAGCAGGG + Intronic
1140097434 16:71886827-71886849 GGGTGCCAGGAGCTGGAGGAAGG - Intronic
1140156231 16:72429551-72429573 TTGTCCCAAGAGCTGTAGTGAGG - Intergenic
1141523065 16:84594294-84594316 CTGTGTCAGGAGCTTTAGGTTGG - Intronic
1141779993 16:86152957-86152979 CTGGGCAAAGACCTGAAGGATGG + Intergenic
1143702212 17:8669284-8669306 CTGAGGGCAGAGCTGTAGGACGG - Intergenic
1144456393 17:15422484-15422506 TTGAGCCAAGACTTGTAGGAAGG + Intergenic
1144722034 17:17477656-17477678 CTGTGCCAAGTGCTACGGGATGG + Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145915821 17:28573494-28573516 CTGGGCCAAGGGCTGTGGTATGG + Exonic
1146702288 17:34971599-34971621 CTGTGCCAAGCAGTGAAGGAGGG + Intronic
1148136617 17:45296675-45296697 CTGGGGGAAGGGCTGTAGGAAGG - Intronic
1148824233 17:50380479-50380501 CTGTACCAGGAGCTGTGGGGAGG - Exonic
1150491105 17:65574964-65574986 TTCTCCCAAGAGCTGTAAGATGG + Intronic
1154021027 18:10664021-10664043 CTTTGCTAAGAGCTGCAGGAGGG + Intergenic
1157061568 18:44297138-44297160 CTCTGCCTAGAGCTCTAGGTAGG + Intergenic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1158360242 18:56664594-56664616 ATGTGCCAAGGGCTGTATTAAGG - Intronic
1158565171 18:58548880-58548902 CTTTGCCAACATATGTAGGAAGG + Intronic
1158682551 18:59581737-59581759 CTGTTCTAAGCACTGTAGGATGG + Intronic
1160336226 18:78042793-78042815 CTGTGGCAAGTGCCCTAGGAAGG - Intergenic
1162520910 19:11178795-11178817 CTGGGCCAGGAGCTGTAACAGGG + Intronic
1164684157 19:30156152-30156174 CTGGGCCCAGAGCAGAAGGAGGG - Intergenic
1165215135 19:34265600-34265622 TTGGGCCCAGAGCTGCAGGAAGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1166144220 19:40823281-40823303 CTGTGCCCAGATGTGTAGGTAGG - Intronic
1167043733 19:47038112-47038134 CTGTGCTGAGACCTGGAGGATGG + Intronic
925620300 2:5785701-5785723 CTGGGACAAGAGCTGTCGGGGGG - Intergenic
926990352 2:18672973-18672995 CTATTCCAAAAGATGTAGGAGGG - Intergenic
927226226 2:20767936-20767958 CTCTGCTGAGAGCTGCAGGATGG + Intronic
927258680 2:21063785-21063807 CAGTGTCAAAAGCTGTAGGCAGG - Intergenic
928409171 2:31041136-31041158 ATGTGCCAATGGCTGTATGAAGG - Intronic
928916653 2:36479191-36479213 TTGTGGCAAGAGCTGTGGGTTGG - Intronic
935723051 2:105996746-105996768 CTGAGCCGTGAGCTGCAGGAAGG - Intergenic
937152578 2:119696106-119696128 CTGGGCCAGGCCCTGTAGGATGG - Intergenic
938401925 2:131000550-131000572 CTGAGCCAAGAGATTTAGGAAGG + Intronic
938646314 2:133334003-133334025 CTGTGATAAGGGCTATAGGAGGG + Intronic
939888814 2:147711243-147711265 CTGGGCTGAGAGCTGAAGGAGGG - Intergenic
941052618 2:160751552-160751574 CTGAGCCAAGAGCTCTATGCAGG + Intergenic
942385987 2:175443591-175443613 CTGTGTCTAGAGCTGTAGAGAGG - Intergenic
942677279 2:178441056-178441078 CTAAGCCAAGACCTGTAGAATGG - Intronic
944529624 2:200654615-200654637 CTGTGCCAAGTGCCATAGTAAGG - Intronic
946440813 2:219693633-219693655 TTGAGCCCAGAACTGTAGGATGG + Intergenic
946948053 2:224842970-224842992 CTGAGCTAAGATCTGAAGGATGG + Intronic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
947821647 2:233075674-233075696 CTCTGCCAAGCGGTGGAGGAAGG - Intronic
948109405 2:235442611-235442633 AACAGCCAAGAGCTGTAGGATGG - Intergenic
948603668 2:239121480-239121502 CTGTTCCAAGGGCTCTTGGATGG + Intronic
948786722 2:240356531-240356553 CTGTGCCCTTTGCTGTAGGAGGG - Intergenic
1169212157 20:3772622-3772644 CAGTCCCAAGAGCTGCAGGTTGG + Intergenic
1169737459 20:8852448-8852470 CTGTCCCAAGAAGTGGAGGAAGG + Intronic
1170389770 20:15859420-15859442 CTGTAAGAAGAGCTGTGGGATGG + Intronic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1171299416 20:24047087-24047109 TTGTGCCAAGTTCTGTGGGATGG + Intergenic
1172040981 20:32045725-32045747 CTGTGCCCAGCCCTGTTGGAGGG - Intergenic
1175407066 20:58741760-58741782 TTATGCCAAGACCTGAAGGATGG + Intergenic
1177080241 21:16630712-16630734 CATTACCAAGAGCAGTAGGAGGG + Intergenic
1177694080 21:24549604-24549626 CTGTGGCAAGATCTGTGAGATGG + Intergenic
1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG + Intergenic
1179193782 21:39145644-39145666 TTAAGCCAAGAGCTGAAGGAGGG + Intergenic
1179405314 21:41121115-41121137 CTGTGTGAAGACCTGAAGGAGGG - Intergenic
1180673476 22:17571133-17571155 CTGTCCCGAGAGCCGTGGGAAGG + Intronic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1184460353 22:44634312-44634334 ATTGGCCAAGGGCTGTAGGAGGG + Intergenic
949493976 3:4614428-4614450 CTGTGCCAGGATCTGTTTGAAGG + Intronic
949927915 3:9056833-9056855 CTGGGCCGAGGGCTGGAGGAGGG + Intronic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
950674909 3:14548855-14548877 CTGTGCAAAGGGCTCAAGGAGGG - Intergenic
951471630 3:23062683-23062705 CTGTGCCAAGAACTGCATGGTGG - Intergenic
952198051 3:31096676-31096698 CTTTGCCAAAAGTTGTAGCAGGG - Intergenic
953155798 3:40372114-40372136 CTCCTCCAAGAGCTGGAGGATGG - Intergenic
953472428 3:43178603-43178625 CTGAGGCCAGAGCTCTAGGAGGG - Intergenic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
954122383 3:48507007-48507029 CTGTTTACAGAGCTGTAGGAAGG - Intergenic
956726362 3:72159725-72159747 CTGTGCTAGGGGCTCTAGGATGG - Intergenic
959393943 3:105812434-105812456 CTGTGCCAAGAGCTATGCAAAGG + Intronic
961774514 3:129274740-129274762 CTGTGGAAAGAGTTGCAGGAAGG + Intronic
962848978 3:139293856-139293878 CTGTGCCAAGAACTGTGCTAGGG - Intronic
966311827 3:178602537-178602559 CAGTACCCAGAGCTGTAGTAGGG - Intronic
968532604 4:1101688-1101710 CTATGGCAGGAGCTGGAGGAGGG - Intronic
969174172 4:5386109-5386131 GTGGGCCAAGAGCTGTGGGTGGG - Intronic
970964126 4:21908344-21908366 TTGAGCCAAGACCTGAAGGAGGG - Intronic
970965380 4:21922230-21922252 ATGGGCCAAGAGCAGTAGGGTGG - Intronic
971604485 4:28639498-28639520 TTGTCCCATCAGCTGTAGGATGG + Intergenic
975240112 4:72047339-72047361 ATAGGCCCAGAGCTGTAGGAGGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976814242 4:89128293-89128315 CTGTGTCAAGGGCTGTAGTCTGG - Intergenic
977285145 4:95095396-95095418 CGGTACAAATAGCTGTAGGATGG + Intronic
980711569 4:136575442-136575464 ATGTGAGAAGAGCTGTAGGAGGG + Intergenic
983130403 4:164012251-164012273 CAGTGCCTGGAGTTGTAGGAGGG - Intronic
986343278 5:6811127-6811149 CTATGCCAAGGCCTGTGGGAAGG - Intergenic
986386313 5:7237642-7237664 CTGTGCACAGATGTGTAGGAGGG + Intergenic
990269387 5:54119118-54119140 CTGTGCAAAGAGCCGTTGGAAGG - Intronic
997690676 5:135825714-135825736 CTCTGCCGAGACCTGCAGGACGG - Intergenic
997700180 5:135892052-135892074 CTGTGGCTGGAGCTGCAGGAGGG - Intergenic
997709291 5:135990490-135990512 CTGAGCCAAGATCTGAAAGACGG + Intergenic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
1002322304 5:178383148-178383170 CTGCACCCAGAGCTGGAGGAGGG - Intronic
1002372253 5:178764373-178764395 CTGGGCCATGTGCTGTATGAAGG - Intergenic
1002395548 5:178950243-178950265 CTGTGCCATGAGCTAGGGGAAGG + Intronic
1004167171 6:13266973-13266995 CTGTGCCCAGAGCTCAGGGATGG - Exonic
1004217369 6:13715269-13715291 GTGTGCCAAGATCTATAGTATGG + Intergenic
1004853274 6:19722968-19722990 GTGTGCCAGGAGATGTAGAAGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006414352 6:33894616-33894638 CCATGCCAGGAGCTGCAGGAGGG - Intergenic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1008264421 6:49406827-49406849 ATGTGTCAAGAGTTGAAGGATGG + Intergenic
1010784925 6:79990023-79990045 TTGTGCCATGAACTGTATGAAGG - Intergenic
1014329136 6:120037968-120037990 CTGTGGCAAGAACTGTAACATGG + Intergenic
1015328282 6:131950056-131950078 CTGTTCCAAGACCTGTGGGATGG - Exonic
1021519876 7:21528368-21528390 GTGTGCCAAGAGCTCTGTGAAGG - Intergenic
1023080366 7:36521051-36521073 CTGAGCCTAGAGTTGGAGGAAGG + Intronic
1024046182 7:45587234-45587256 CTCTGCCCAGAGCTGTGGCATGG + Intronic
1024263247 7:47587490-47587512 CTGTGCTAAGAGCTTCAGGAGGG - Intergenic
1027183847 7:75958052-75958074 CTGAGCAAAGAGCTCTATGATGG - Intronic
1029146974 7:98453414-98453436 GTGTACCAAGAGCAGGAGGAAGG + Intergenic
1030902540 7:115142055-115142077 CTGTGCCAAGACCTGTTCCAAGG + Intergenic
1031340779 7:120597715-120597737 CTCTCCCAAGATCTTTAGGATGG - Intronic
1031493903 7:122423158-122423180 CTATGGCCAGAGCTGGAGGAAGG - Intronic
1032168852 7:129567364-129567386 ATGAGCCAAGAACTGTGGGAGGG + Intergenic
1033553128 7:142465516-142465538 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033555465 7:142484964-142484986 CTGAGGCCAGAGCTGCAGGAGGG - Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033637937 7:143229541-143229563 CAGTCCCGAGAGCTGTAGGCAGG - Intergenic
1034235734 7:149567621-149567643 CTGTGACAAGAGCAGAAGTAGGG + Intergenic
1034539862 7:151750580-151750602 ATCTGCTAAGAGCTGTGGGAAGG + Intronic
1035460116 7:159033352-159033374 CTGTGCACAGAGCTGTACCATGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1037746929 8:21653017-21653039 TTGAGCCAAGAGCAGTATGAAGG - Intergenic
1038728025 8:30098992-30099014 CTGAGCAAAGATCTGTATGAGGG - Intronic
1041629556 8:60070943-60070965 CTGTACCCAGTGCAGTAGGATGG - Intergenic
1042306577 8:67339691-67339713 CTCTGCAGAGAGCTGTAGTAGGG + Intronic
1042818850 8:72908532-72908554 CTATGCTATGAGCTGTTGGAAGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046537262 8:115531439-115531461 CTAGGCCATGAGCTGAAGGAAGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047916518 8:129589738-129589760 CTTTGCCAGGTGCTGCAGGATGG - Intergenic
1048849586 8:138631710-138631732 CTGAGCTAAGACCTGTAGGATGG - Intronic
1049000447 8:139822601-139822623 GAGAGCCAAGAGCCGTAGGATGG + Intronic
1050184234 9:2955669-2955691 CAGTGCCAAGAGCTTTAGCCAGG - Intergenic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1053007661 9:34614728-34614750 CTGGGCCAAGCGCTGCAGGCGGG + Exonic
1053279197 9:36806424-36806446 CAGTCCCAAGTGGTGTAGGAGGG + Intergenic
1055473902 9:76642504-76642526 CTGTGCCAAAAACTGTAAGGTGG - Intronic
1056331484 9:85524635-85524657 CTGTGGGAACACCTGTAGGAAGG + Intergenic
1056690870 9:88807671-88807693 CTGTGCCAACACCTGTGGGCAGG + Intergenic
1057558610 9:96109495-96109517 CAGTGCTAAGAGCTGCAGGGTGG + Intronic
1057826681 9:98377264-98377286 CTGTCCACAGAGCTGTATGAAGG - Intronic
1059585300 9:115599576-115599598 CTGTGCTAAGTGCTGAAGAAAGG + Intergenic
1061061440 9:128252477-128252499 CTGGGCCAAGAGCTGCAGTGTGG + Intronic
1061222032 9:129257890-129257912 CAGTGCCAAGAGCTGGGGGCAGG - Intergenic
1061288973 9:129640209-129640231 CTGTGCCCAGAGCTAAGGGAAGG - Intronic
1061660858 9:132129471-132129493 CTGTGGCTAGAGCTGGAGGGAGG + Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1192338003 X:70237986-70238008 CTGAGCCAAAACCGGTAGGAAGG - Intronic
1192365241 X:70466822-70466844 CTGTGCCCAGAGGTTTAGAAGGG + Intronic
1193669029 X:84360580-84360602 TGGTGCCAAGAGCTGAGGGAGGG - Intronic
1196856668 X:119991108-119991130 CTGTTCCATGAGCTCCAGGAAGG + Intergenic
1197923500 X:131621558-131621580 CTGTGCCAAGGGCTGTTATAAGG - Intergenic
1199061744 X:143363759-143363781 CTTTTCCAACAGCTGTTGGAGGG - Intergenic