ID: 912682404

View in Genome Browser
Species Human (GRCh38)
Location 1:111737916-111737938
Sequence AGGGGCCAGCTCTGGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912682404_912682418 27 Left 912682404 1:111737916-111737938 CCCTACCCCCAGAGCTGGCCCCT No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682404_912682413 7 Left 912682404 1:111737916-111737938 CCCTACCCCCAGAGCTGGCCCCT No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912682404 Original CRISPR AGGGGCCAGCTCTGGGGGTA GGG (reversed) Intronic
No off target data available for this crispr