ID: 912682413

View in Genome Browser
Species Human (GRCh38)
Location 1:111737946-111737968
Sequence TGCCAAGTTCCTTCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 155}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912682403_912682413 8 Left 912682403 1:111737915-111737937 CCCCTACCCCCAGAGCTGGCCCC 0: 1
1: 0
2: 10
3: 80
4: 583
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682406_912682413 2 Left 912682406 1:111737921-111737943 CCCCCAGAGCTGGCCCCTAACAC 0: 1
1: 0
2: 1
3: 32
4: 273
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682407_912682413 1 Left 912682407 1:111737922-111737944 CCCCAGAGCTGGCCCCTAACACA No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682408_912682413 0 Left 912682408 1:111737923-111737945 CCCAGAGCTGGCCCCTAACACAC No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682409_912682413 -1 Left 912682409 1:111737924-111737946 CCAGAGCTGGCCCCTAACACACT No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682402_912682413 9 Left 912682402 1:111737914-111737936 CCCCCTACCCCCAGAGCTGGCCC 0: 1
1: 0
2: 4
3: 64
4: 548
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682400_912682413 28 Left 912682400 1:111737895-111737917 CCTGCAGTTTCAAACTCTGCCCC No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682404_912682413 7 Left 912682404 1:111737916-111737938 CCCTACCCCCAGAGCTGGCCCCT No data
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155
912682405_912682413 6 Left 912682405 1:111737917-111737939 CCTACCCCCAGAGCTGGCCCCTA 0: 1
1: 0
2: 8
3: 65
4: 3446
Right 912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912682413 Original CRISPR TGCCAAGTTCCTTCCCAAGC AGG Intronic
900110229 1:1002091-1002113 CCCCAAATTTCTTCCCAAGCCGG - Intergenic
903103879 1:21057082-21057104 TGCCAAATTGCTTCCCAAAGTGG - Intronic
903836162 1:26204524-26204546 AGGCTAGTTCCTTCCCAAACTGG + Intergenic
903970360 1:27114854-27114876 CCCCAAGTTCCTTCCCACGCTGG - Intronic
904380984 1:30110948-30110970 TGCCAAGCTGTTTCCCAAGGTGG + Intergenic
904907582 1:33909550-33909572 TGCCAAGTTCAATGTCAAGCAGG + Intronic
905613129 1:39372782-39372804 TGCAAAATTCCTTCCCATGATGG + Intronic
909739706 1:79012697-79012719 CCCCAAGTTCCTTCCCAGCCTGG + Intergenic
910721672 1:90293648-90293670 TGCCCAGAGCCTTCTCAAGCAGG + Intergenic
912682413 1:111737946-111737968 TGCCAAGTTCCTTCCCAAGCAGG + Intronic
913196087 1:116457420-116457442 TGCCAAATTCCTTTCCATGGGGG + Intergenic
915107635 1:153544388-153544410 TGCTAAGTAACTTCCCAAGGTGG - Intronic
915172108 1:153985518-153985540 TTCCACGTTCCTCACCAAGCTGG + Intronic
916837893 1:168567471-168567493 TACCAAGTTCATGGCCAAGCTGG - Intergenic
917615661 1:176741374-176741396 TGCTCAATTCCTTGCCAAGCAGG + Intronic
917627445 1:176860338-176860360 ATCCAAGTCCCTGCCCAAGCAGG - Intronic
920506141 1:206516889-206516911 GGCCAAGTTCCTTGCCCTGCTGG - Intronic
920709552 1:208282026-208282048 TCCCAAGTTTCTTTCCAAGCAGG - Intergenic
921738420 1:218655308-218655330 TGCCAAGATCCTCCCAGAGCTGG - Intergenic
923782486 1:237037433-237037455 TGCCTAGTGGCTTCCCAAGTAGG - Intergenic
924533882 1:244917759-244917781 TGCTAAGTTCTTCCACAAGCTGG - Intergenic
1066531551 10:36345995-36346017 TGCCCATTTCCTTAACAAGCTGG - Intergenic
1068350713 10:55841333-55841355 TTCTGAGTTCTTTCCCAAGCTGG + Intergenic
1068851430 10:61746366-61746388 TGCGAAGTTTTTTACCAAGCTGG - Intronic
1070342632 10:75511554-75511576 TGCCAAAGCCTTTCCCAAGCTGG - Intronic
1071922009 10:90360997-90361019 TCCCAAGTTCCAGCCCAAGCTGG - Intergenic
1074314274 10:112347396-112347418 TGACAATTTCCTTCCCCAGGAGG - Intergenic
1078927465 11:15887420-15887442 AGCCTACTGCCTTCCCAAGCAGG + Intergenic
1079560092 11:21811255-21811277 TGTCAGGTTCCCACCCAAGCTGG - Intergenic
1079560660 11:21814725-21814747 TGTCAGGTTCCAACCCAAGCTGG - Intergenic
1080818504 11:35782208-35782230 TTCCAAGATCCTACCCCAGCTGG - Intronic
1081041901 11:38223790-38223812 AGGCAAGGTCCTTCCCAATCCGG + Intergenic
1081623003 11:44630226-44630248 TGCCCAGTTCTTGCCCAGGCTGG + Intergenic
1082098336 11:48150214-48150236 TGTCAGGTTCCAACCCAAGCTGG + Intronic
1084196964 11:67528522-67528544 TGCCAAATTCCTTTCCAAAGTGG - Intergenic
1087086158 11:94220784-94220806 TGCTGAGTTCTTTCCCATGCAGG + Intergenic
1089202661 11:116733717-116733739 TGCCAAGATTCTCCCCAGGCTGG + Intergenic
1096214146 12:49790301-49790323 TGCCAAACTCCTTCCCCAGAAGG + Intergenic
1096301958 12:50437035-50437057 TGCCAAGTTCCAGCCTAAACAGG - Intronic
1098442458 12:70533142-70533164 TGCCAAATTCCTCCCCAAAATGG + Intronic
1098453283 12:70644391-70644413 TGCCAAGTTCATTACCAGGGGGG + Intronic
1101588656 12:106107484-106107506 TGCCTAGTTCCCTTCCAGGCTGG + Intronic
1103063280 12:117876033-117876055 TCCCAAGTCCTTTTCCAAGCGGG + Intronic
1103928142 12:124435067-124435089 TGCCAGGTTCTGTCCCAAGCTGG + Intronic
1104416546 12:128600558-128600580 TGCAAAGGTGTTTCCCAAGCAGG - Intronic
1105252128 13:18708782-18708804 TGCCCAGAGCCTTCTCAAGCAGG - Intergenic
1106289997 13:28352016-28352038 TGCCAAGTTCCTTACCTTCCTGG - Intronic
1113877989 13:113606525-113606547 TTCCAAATACCGTCCCAAGCAGG + Intronic
1118901129 14:69986863-69986885 TGTCAGGTTCTTTCCAAAGCAGG - Intronic
1118905316 14:70019177-70019199 AGCCAAGTTCCTCCCCAAACTGG - Intronic
1119811181 14:77520978-77521000 TGTCATTTTCCTTCCCAAGGAGG + Intronic
1121001241 14:90453506-90453528 TGCCAGGTTCCCTCACAAGCAGG + Intergenic
1121495792 14:94390676-94390698 TGCCCAGTTCCTGCCCACCCAGG + Exonic
1123981628 15:25610006-25610028 TGCCAAGTTGCTTACCCAGAAGG + Intergenic
1129164891 15:73771322-73771344 TTCCACCTTCCTTCCCAGGCAGG + Intergenic
1129343974 15:74905109-74905131 AGCCAAGTTGCTTCCCAAGGGGG + Intronic
1131130519 15:89896942-89896964 TGCCAAATTGCTTCCCAAAAGGG - Exonic
1132709901 16:1261783-1261805 AGCCACCTTCCTTCCCAACCTGG - Intergenic
1134332991 16:13267462-13267484 TGCCAAGTTGCTTTCCAAAAGGG - Intergenic
1134538201 16:15043546-15043568 TGCCAAATTGCTTCCCAGACAGG + Intronic
1138731451 16:59199886-59199908 TCCCACTATCCTTCCCAAGCTGG + Intergenic
1141523181 16:84594924-84594946 TGCCAAGTGCCTCCACATGCCGG + Intronic
1141658775 16:85430497-85430519 TTCCAAGGTCATTCCCAGGCCGG - Intergenic
1142430043 16:90021261-90021283 TGGCAACTTCCTCCCCCAGCTGG + Intronic
1142946843 17:3436676-3436698 TGAGAAGTTCCTTCCCTAGAGGG + Intergenic
1144148804 17:12423576-12423598 TGCCAAGTCACTTTCAAAGCTGG - Intergenic
1144687210 17:17234109-17234131 TGGCAGTTTCCTTCTCAAGCAGG + Intronic
1144838993 17:18174083-18174105 TGCCAAGTTGCTTCCCTGGATGG - Intronic
1145221230 17:21090930-21090952 AGCCAACTTCTGTCCCAAGCAGG + Intergenic
1148339384 17:46864241-46864263 TGGCAAGTTCCTACCCAACCAGG - Intronic
1149691901 17:58584184-58584206 GGCAAAGCTCCTTCCCCAGCAGG - Intronic
1151919788 17:77145658-77145680 CACCAAACTCCTTCCCAAGCTGG - Intronic
1152941250 17:83173872-83173894 TGCCAGGCTCTGTCCCAAGCGGG + Intergenic
1155008617 18:21752695-21752717 TGCCAAGTTGCTTCTCAAAGTGG - Intronic
1156062474 18:33097147-33097169 TGCTAAGTGACTTCCCAGGCTGG + Intronic
1156377295 18:36526166-36526188 TGCCAAGTTCCTTACGACGAGGG - Intronic
1158537527 18:58321801-58321823 TGTGAAGTTCCTACCAAAGCAGG - Intronic
1162452113 19:10761463-10761485 ACCCAAGATCCTTCCCAAGGAGG - Intronic
1164702958 19:30298703-30298725 TCCCAGGTTCCTTCCCAGACTGG - Intronic
926308239 2:11655813-11655835 TGCCAATTTGCTTTCCAAGAAGG + Intergenic
927874516 2:26646332-26646354 TGCCAAATTCTTTCCCAAAGCGG - Intergenic
929605053 2:43227962-43227984 GGCCTAGTTCTTTCCCCAGCGGG - Intergenic
929982628 2:46696312-46696334 AGCCAAGCTCCTTTCCCAGCTGG - Intergenic
930605658 2:53490574-53490596 TGTCAGGTTCCAGCCCAAGCTGG + Intergenic
936476305 2:112842994-112843016 TAACAAGTCCTTTCCCAAGCTGG + Intergenic
938075188 2:128328509-128328531 TGCCAAGCTCCTTTCCAGGATGG + Intergenic
939926230 2:148177118-148177140 TTCAAAGTTCCTTCCTAAGCTGG + Intronic
940233710 2:151486421-151486443 TGCCAAATTCTTTTCCAAGGTGG - Intronic
942889756 2:180975146-180975168 TGCCAAATTGCTTCCCAAAAAGG + Intronic
946575517 2:221071508-221071530 TCCCAGCTTCCTTCACAAGCTGG + Intergenic
948227694 2:236324540-236324562 TGCTAAGTTCCTTCCCCTGAGGG + Exonic
948581326 2:238988944-238988966 TGCCAGAGTCCTGCCCAAGCAGG - Intergenic
1170738683 20:19033591-19033613 TTCCAAGTTCTTTTCCAAGAAGG - Intergenic
1172056568 20:32158378-32158400 CCCCAAGCTCCTTCCCAAGCTGG - Intronic
1172580624 20:36044473-36044495 TTCCAATTGCCTTCCCAACCCGG - Intergenic
1176151598 20:63594308-63594330 GGCCCAGTTCCTTCCCTGGCAGG + Intronic
1176837655 21:13808634-13808656 TGCCCAGAGCCTTCTCAAGCAGG - Intergenic
1178229445 21:30764457-30764479 TGCCACCTTCTTTCCCCAGCAGG + Intergenic
1178479060 21:32963472-32963494 TGCCTGGTGCCTTCCCAGGCAGG - Intergenic
1180068585 21:45424896-45424918 TGCCAGGATCCTTCCCCAGCTGG + Intronic
1181630742 22:24149974-24149996 GGCCAGGTTCCTTCCCCATCAGG - Intronic
1184209821 22:43028889-43028911 TGACAAGCTCCTGCCCAGGCTGG + Intergenic
1184586681 22:45452702-45452724 TTCCAAGGTGCTTCTCAAGCTGG - Intergenic
1184921450 22:47608481-47608503 TACCAAGTGCCTTCCCAAGGAGG - Intergenic
949090946 3:28469-28491 TGCCAAATATCTTCCCAAACAGG + Intergenic
950017764 3:9766213-9766235 TGTTAATTTCATTCCCAAGCAGG - Exonic
950792880 3:15487525-15487547 TCCCAAGTGCCTTCCCATGCAGG - Intronic
953650893 3:44802668-44802690 TGCCAAGTTGCTTTCCATGGTGG + Intronic
954831152 3:53422354-53422376 GGTCCAGTTCTTTCCCAAGCAGG + Intergenic
955509758 3:59667751-59667773 TGCCAAGTCCTTCCCCAGGCTGG - Intergenic
956711981 3:72047149-72047171 TACCAAGGGCCTTCCCCAGCTGG + Intergenic
957031265 3:75244677-75244699 TGCCAAATATCTTCCCAAACAGG + Intergenic
957930087 3:86866166-86866188 TGCCAAGTGCCATCTCAAGCAGG - Intergenic
960619915 3:119627724-119627746 AGTCAAATTCCTTCCCTAGCTGG + Intronic
963598515 3:147357552-147357574 TGCCAAGTTCCCTCCCCAGCGGG + Intergenic
967996335 3:195169340-195169362 TGCCGAGTGCCTTCCAAGGCTGG - Intronic
968522600 4:1040822-1040844 TGCCAGGCCCCTCCCCAAGCTGG + Intergenic
970725026 4:19033736-19033758 GTCCAAGGTCTTTCCCAAGCTGG + Intergenic
971179288 4:24313376-24313398 TGCCATGTTCCAGCCAAAGCAGG + Intergenic
972579925 4:40386071-40386093 TGCCAAGTTGCTTGCCAAAGAGG - Intergenic
975837219 4:78436391-78436413 TGCCAAATTCCTTCCCAAAGTGG - Intronic
978768359 4:112428565-112428587 TGCAAACTTCCTTCCCATCCTGG + Intronic
981707746 4:147679234-147679256 TGCCATGTTGTTGCCCAAGCTGG - Intronic
983087343 4:163463286-163463308 TACCAAGATCCTTCCAAAGTAGG + Intergenic
983271569 4:165568185-165568207 TGCAAAGTTCCTCCCCAAAGAGG - Intergenic
983387945 4:167090192-167090214 TGCCAAATTGCTTCCCAAATTGG + Intronic
984754003 4:183307887-183307909 TGCTGACGTCCTTCCCAAGCGGG - Intronic
987561672 5:19531503-19531525 TGCCAAATTGCTTTCCAAACTGG - Intronic
991132874 5:63145314-63145336 TGCCAAGTTTCTTCACAGGCTGG + Intergenic
994589646 5:101758012-101758034 TGCCAGGTTGCAACCCAAGCTGG + Intergenic
994590284 5:101762365-101762387 TGTCAGGTTCCAACCCAAGCTGG + Intergenic
996004896 5:118407818-118407840 AGGCAAGTTCATTCCCAAGTTGG - Intergenic
1000342374 5:160287737-160287759 TGCCAAGCTCCTGCCTAATCTGG - Intronic
1000534094 5:162458434-162458456 TTCCCTGTTCCTCCCCAAGCTGG - Intergenic
1002397539 5:178969777-178969799 TGCCAATTCCCTTCTCAAACTGG - Intergenic
1006652526 6:35563415-35563437 AGATAAGGTCCTTCCCAAGCTGG + Intergenic
1007152519 6:39708162-39708184 TGCCAAGGTCATTGCCCAGCAGG - Intronic
1010016881 6:71115163-71115185 TGCCAAATTGCTTCCCAGACAGG - Intergenic
1010958230 6:82116003-82116025 TCCCAAGTCCCTTTCCATGCGGG + Intergenic
1011626475 6:89287365-89287387 TGCCTGGTTGCTTCCCCAGCTGG - Intronic
1013016549 6:106165089-106165111 TCACGAGTTCATTCCCAAGCAGG + Intergenic
1016052813 6:139548129-139548151 TGCAAAGGTCCTTCCCAAAATGG - Intergenic
1017790465 6:157793631-157793653 AGCTAAGTTCCTTAGCAAGCAGG + Intronic
1021577418 7:22117006-22117028 TTCCTATTCCCTTCCCAAGCTGG + Intergenic
1024612136 7:51076068-51076090 TGCCACTTTCCTTCCCTGGCAGG - Intronic
1024936565 7:54717644-54717666 TGCCAAGTTCCTCAGCAACCAGG + Intergenic
1025150162 7:56541281-56541303 GGCCATCCTCCTTCCCAAGCAGG + Intergenic
1025218468 7:57081885-57081907 TCCCAAGTACCTTCCTAATCTGG + Intergenic
1025652880 7:63488576-63488598 TCCCAAGTACCTTCCTAATCTGG - Intergenic
1026392320 7:69913868-69913890 TGCCAAGTTCCTTCGTACCCTGG + Intronic
1027640244 7:80724104-80724126 TGCCATGTTCCTTCTCATTCTGG - Intergenic
1027708280 7:81563820-81563842 TGCCAAGTTGCTTTCCAAAGAGG - Intergenic
1028071492 7:86456630-86456652 TGCCAAATTCCTTTCCAAAGTGG - Intergenic
1034624304 7:152480766-152480788 TGTCAAGTGCCTTCTCAAGGCGG + Intergenic
1039120452 8:34140471-34140493 TGCCAAGTTTCTTATCAAGCTGG - Intergenic
1043004063 8:74796360-74796382 TGCCAGCCTCCTTCCCCAGCAGG - Intronic
1043408204 8:79961684-79961706 AGCCACGTTCTTTCCCAATCAGG + Intronic
1044106429 8:88212915-88212937 TACCAAGTTCATTCCCCAGGAGG - Intronic
1050325777 9:4495891-4495913 TGCCATGTTCTTTTCCAAGTCGG - Intronic
1053444464 9:38141102-38141124 TGCCACCTTCATTCCCAAGTAGG - Intergenic
1058109851 9:101020226-101020248 TCCCAAGTATCATCCCAAGCTGG - Intergenic
1059310909 9:113388598-113388620 AGGCAAGTTCCTTCCCATGCTGG + Intronic
1060297832 9:122355239-122355261 GGCCAAGGTCCTTCCCCAGTTGG - Intergenic
1061720856 9:132550465-132550487 CCCCAAATTCCTTCCCAAGCTGG - Intronic
1061957593 9:133971662-133971684 TGCCCTGCTCCTTCCCACGCTGG - Intronic
1062124665 9:134853494-134853516 TGCCAGCTCCCCTCCCAAGCTGG + Intergenic
1062212392 9:135372096-135372118 TGCCAAATTCCATCCCACCCGGG + Intergenic
1185893075 X:3837081-3837103 TTCCTAGTTCCTTCCCAAGAAGG + Intronic
1185898187 X:3875503-3875525 TTCCTAGTTCCTTCCCAAGAAGG + Intergenic
1185903302 X:3913932-3913954 TTCCTAGTTCCTTCCCAAGAAGG + Intergenic
1188245639 X:27833071-27833093 TCCCCAGTGCCTTCCCAACCTGG + Intergenic
1188280912 X:28268348-28268370 TACCAATTCCCTTTCCAAGCAGG + Intergenic
1191689818 X:63928011-63928033 TCCCAGCTTCCTTCACAAGCTGG - Intergenic
1192595075 X:72398023-72398045 TGCCAAATTGTTTCCCAAGTTGG + Intronic
1193508799 X:82373594-82373616 TGTCAGGTTCCAACCCAAGCTGG + Intergenic
1194135912 X:90141497-90141519 TGCCAAGTACCCTGACAAGCTGG + Intergenic
1195393944 X:104391167-104391189 TGCCCATTTCCATCTCAAGCAGG + Intergenic
1198639954 X:138745800-138745822 AGACAAGCTCCTTCCCCAGCAGG - Intronic
1200481668 Y:3711573-3711595 TGCCAAGTACCCTGACAAGCTGG + Intergenic