ID: 912682418

View in Genome Browser
Species Human (GRCh38)
Location 1:111737966-111737988
Sequence AGGAAGAGTGTAGCCTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912682405_912682418 26 Left 912682405 1:111737917-111737939 CCTACCCCCAGAGCTGGCCCCTA 0: 1
1: 0
2: 8
3: 65
4: 3446
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682414_912682418 -5 Left 912682414 1:111737948-111737970 CCAAGTTCCTTCCCAAGCAGGAA No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682407_912682418 21 Left 912682407 1:111737922-111737944 CCCCAGAGCTGGCCCCTAACACA No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682404_912682418 27 Left 912682404 1:111737916-111737938 CCCTACCCCCAGAGCTGGCCCCT No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682403_912682418 28 Left 912682403 1:111737915-111737937 CCCCTACCCCCAGAGCTGGCCCC 0: 1
1: 0
2: 10
3: 80
4: 583
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682406_912682418 22 Left 912682406 1:111737921-111737943 CCCCCAGAGCTGGCCCCTAACAC 0: 1
1: 0
2: 1
3: 32
4: 273
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682412_912682418 7 Left 912682412 1:111737936-111737958 CCTAACACACTGCCAAGTTCCTT No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682409_912682418 19 Left 912682409 1:111737924-111737946 CCAGAGCTGGCCCCTAACACACT No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682402_912682418 29 Left 912682402 1:111737914-111737936 CCCCCTACCCCCAGAGCTGGCCC 0: 1
1: 0
2: 4
3: 64
4: 548
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682410_912682418 9 Left 912682410 1:111737934-111737956 CCCCTAACACACTGCCAAGTTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682411_912682418 8 Left 912682411 1:111737935-111737957 CCCTAACACACTGCCAAGTTCCT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178
912682408_912682418 20 Left 912682408 1:111737923-111737945 CCCAGAGCTGGCCCCTAACACAC No data
Right 912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912682418 Original CRISPR AGGAAGAGTGTAGCCTTTGC AGG Intronic
900877759 1:5357689-5357711 AGGAAGAGAGTAACCTTCCCAGG - Intergenic
902568873 1:17333707-17333729 AGGCAGAGTGTCTCCATTGCTGG + Intronic
902774564 1:18666480-18666502 AGGAAGACTATGGCATTTGCAGG - Intronic
905520670 1:38597138-38597160 AGGAAGAGTGGAAACTTTTCAGG + Intergenic
905784094 1:40738888-40738910 AGAACGACTGTAGGCTTTGCTGG - Exonic
907512732 1:54973748-54973770 GGGAAGAGTGTGTCCCTTGCAGG + Intergenic
907999970 1:59670209-59670231 AGGAAGAGGGCAGCTTTGGCTGG - Intronic
912370428 1:109169798-109169820 AGGAACAGTGTAGCAGTAGCTGG + Intronic
912682418 1:111737966-111737988 AGGAAGAGTGTAGCCTTTGCAGG + Intronic
919840660 1:201606777-201606799 AGTGGGAATGTAGCCTTTGCTGG - Intergenic
922350318 1:224729856-224729878 AGGGACAGTGTAGCCTCTGGGGG - Intronic
923543511 1:234907184-234907206 AGGCCAAGTGTATCCTTTGCTGG - Intergenic
924165125 1:241273182-241273204 AGAAGGAGTGTATCCTTTGGGGG - Intronic
1063711175 10:8480191-8480213 AGCAAGATTGTGTCCTTTGCAGG - Intergenic
1067537600 10:47125409-47125431 AGGAACAGTGCACTCTTTGCTGG + Intergenic
1070414347 10:76175714-76175736 GGGAAGAGTGAAGCCTTGGCGGG + Intronic
1070421396 10:76241151-76241173 AGGTACAGTGTACACTTTGCAGG + Intronic
1071051858 10:81460035-81460057 CCAAAGAGGGTAGCCTTTGCCGG - Intergenic
1074105016 10:110382861-110382883 AGGAAGAGTGTCGGCCTTGGGGG + Intergenic
1075551821 10:123398309-123398331 AGGAAGAATGGAGACTTAGCAGG - Intergenic
1076829064 10:132985226-132985248 AGGAAGGGTGGTGCCTTTGGAGG + Intergenic
1080096030 11:28407984-28408006 AACAAGATTGTGGCCTTTGCAGG + Intergenic
1080458164 11:32433490-32433512 AAGCAGAGTGTATCTTTTGCAGG - Intronic
1081944593 11:46979107-46979129 AGAAAAAGTATAGCCTTTGGGGG - Intronic
1088043990 11:105425070-105425092 AGAAAGAGTCAAGACTTTGCAGG - Intergenic
1088175660 11:107050428-107050450 AGAAAGAGTGTAATCATTGCAGG - Intergenic
1091802976 12:3336446-3336468 GGTAAGAGTGCAGGCTTTGCAGG - Intergenic
1092659273 12:10722129-10722151 GGGAAGCGTGTAGCCATTGGTGG + Intronic
1093999006 12:25674365-25674387 AAGAAGAGGGTGGCCTTGGCTGG - Intergenic
1097624842 12:61987576-61987598 AGGAAGGGTGCAGACTTTTCTGG - Intronic
1102473274 12:113172364-113172386 AGGAAGAGTTTGCCCTTGGCGGG + Exonic
1103685590 12:122729883-122729905 GGGAACAGTGTATCTTTTGCTGG - Exonic
1104450506 12:128864794-128864816 AGAAGGAGTGTGGCCTCTGCTGG + Intronic
1105239658 13:18598289-18598311 AGGAAGAGCGTACCCTAGGCTGG - Intergenic
1105272505 13:18891596-18891618 AGGAAAAGTGTAGCCTTCCAGGG + Intergenic
1111072729 13:83189242-83189264 AGCCAGAGGGTAGCCTTTGAAGG + Intergenic
1111703083 13:91715072-91715094 AGGAAAAGGGTAGCCATTTCTGG + Intronic
1113328263 13:109304457-109304479 AGAAAGCGTGAAGCCTCTGCAGG - Intergenic
1114065090 14:19053670-19053692 AGGAAGAGTGCACCCTAGGCTGG - Intergenic
1114097172 14:19346332-19346354 AGGAAGAGTGCACCCTAGGCTGG + Intergenic
1116707034 14:48315579-48315601 AACAAGAGTGAAGCCTTTACCGG - Intergenic
1116740311 14:48746564-48746586 ACAAAGAGGGTAGCCATTGCTGG - Intergenic
1118033461 14:61840516-61840538 AGGAAGAGGGTGGCCGTAGCAGG + Intergenic
1118356421 14:65017576-65017598 AGGAAGAGAGGAGCCTTTAAAGG + Intronic
1118493274 14:66282422-66282444 AGGAAAAGTGTGCCCTTTCCAGG + Intergenic
1121437317 14:93928234-93928256 ATGAAGAGGGTAGGCTCTGCTGG - Exonic
1121437513 14:93929012-93929034 AGGAAGAGCCCAGCCTTTCCCGG + Exonic
1122165789 14:99822806-99822828 AGGAGGAGTGTGGCTTTGGCTGG - Intronic
1123491534 15:20785484-20785506 AGGAAGAGTGGACCCTAGGCTGG + Intergenic
1123548038 15:21354578-21354600 AGGAAGAGTGGACCCTAGGCTGG + Intergenic
1123740044 15:23226812-23226834 AGGAAGAGTGTACCCTGTTCCGG - Intergenic
1124291269 15:28455780-28455802 AGGAAGAGTGTACCCTGTTCCGG - Intergenic
1126781655 15:52144141-52144163 AGGAAGAGAGCAGCCTTACCAGG - Intronic
1131897836 15:97053143-97053165 AGTAAGCATGTAGCCTTTTCAGG + Intergenic
1132270610 15:100520712-100520734 AGGCAGAGTGTTGCCTTGGATGG + Intronic
1202956368 15_KI270727v1_random:81808-81830 AGGAAGAGTGGACCCTAGGCTGG + Intergenic
1132699600 16:1216667-1216689 AGGAAGAGAGAAGCCAGTGCGGG + Intronic
1133267671 16:4594601-4594623 AGACAGAGTGCAGCCTCTGCTGG - Intronic
1133821949 16:9244822-9244844 AGGAACAGTATGGCCTTTGTTGG + Intergenic
1134443874 16:14316000-14316022 GTGAAGATTTTAGCCTTTGCAGG + Intergenic
1135623585 16:23976508-23976530 AGGATGAGGGCAGCCTTAGCTGG + Intronic
1136760405 16:32727526-32727548 AGGAAGAGTGTACCCTGTCCCGG - Intergenic
1136807698 16:33142860-33142882 AGGAAGAGTGTACCCTGTCCCGG + Intergenic
1139211601 16:65083223-65083245 GGGAAGAGTGCAGGCTTTGCAGG - Intronic
1139629774 16:68222918-68222940 AGGAAGAGTGTTTTCTGTGCAGG - Intronic
1139791142 16:69436415-69436437 AGGAATGGTGTAACCTTGGCAGG - Intronic
1143120264 17:4602263-4602285 AGGGAGAGTGCTCCCTTTGCAGG + Intronic
1145728515 17:27155337-27155359 TAGAAGAGTGGAACCTTTGCAGG + Intergenic
1147776264 17:42903841-42903863 AAGAAGAGTGTAGCCTGAGAAGG - Intronic
1150228810 17:63538730-63538752 AGGAAGAGGGTGGCCTGGGCAGG - Intronic
1151598307 17:75091149-75091171 AGGAAGGCTGTGGCCTTTCCGGG + Intronic
1154464283 18:14629178-14629200 AGGAAAAGTGTAGCCTTCCAGGG + Intergenic
1156578841 18:38351650-38351672 AGCAAGGATGTAACCTTTGCTGG + Intergenic
1156695230 18:39758138-39758160 AGGAAGATCATATCCTTTGCAGG + Intergenic
1156732636 18:40212951-40212973 ATGATCAGTGTAGCCTTTTCAGG - Intergenic
1157604553 18:48917705-48917727 AGGAGGAGTCTGGCATTTGCTGG - Intergenic
1157913612 18:51642331-51642353 AGGAAGAGTGGTGTTTTTGCTGG + Intergenic
1163636567 19:18439643-18439665 AGGCAGAGAGTGACCTTTGCCGG - Intergenic
1165370502 19:35402666-35402688 AGGAAGAGTGTGGGCCTAGCCGG - Intergenic
1167089769 19:47335841-47335863 AGGAAGGGTGGAGTCTTTGCGGG + Intronic
1167405515 19:49305225-49305247 TGGAAGAGAGCAGCCCTTGCTGG + Intronic
1168414883 19:56161475-56161497 AGGAAATCTGTAGCCTCTGCCGG + Intergenic
925164973 2:1710414-1710436 AGGAGGTGTGAAGCCTTTGGAGG + Intronic
925273166 2:2629763-2629785 AGGAAGGGTGCAGCCTTATCCGG - Intergenic
928376110 2:30776122-30776144 AGGAATTGTGTAGCCTCTGGTGG - Intronic
934566347 2:95343717-95343739 AGGAAGAGTGTGGCCCAGGCAGG + Intronic
936271922 2:111055555-111055577 AGGCAGAGGGAAGCCCTTGCTGG - Intronic
936733242 2:115408264-115408286 AGGAAGTCTGTACCATTTGCAGG - Intronic
937744931 2:125400976-125400998 AGAATGACAGTAGCCTTTGCAGG - Intergenic
938298050 2:130190658-130190680 AGGTAACATGTAGCCTTTGCTGG - Exonic
938458718 2:131484007-131484029 AGGTAACATGTAGCCTTTGCTGG + Exonic
939786586 2:146521006-146521028 AAGAAGATTGTTTCCTTTGCGGG + Intergenic
940481877 2:154242864-154242886 AGGATGGCTGGAGCCTTTGCTGG + Exonic
943678585 2:190743128-190743150 ACAAAGAGTGAAGGCTTTGCAGG - Intergenic
944231299 2:197395619-197395641 AGGAAGAGTGTAGTTCTGGCAGG + Intronic
1169058099 20:2640615-2640637 TGGATGAGTGTGGCCTGTGCTGG - Intronic
1169274943 20:4227449-4227471 AGGAAGAGCTTAGCCTTTAAAGG - Intronic
1170422725 20:16208587-16208609 AGGAAGAGTGTGGCCTATTTTGG + Intergenic
1174482670 20:50842332-50842354 AGGAAGAGAACAGCCTTTGCAGG - Intronic
1175510949 20:59525797-59525819 AGGGAGAGGGTAGTCTTTGGTGG + Intergenic
1176447094 21:6830328-6830350 AGGAAGAGTGGACCCTAGGCTGG - Intergenic
1176810253 21:13529211-13529233 AGGAAAAGTGTAGCCTTCCAGGG - Intergenic
1176825265 21:13695354-13695376 AGGAAGAGTGGACCCTAGGCTGG - Intergenic
1179466234 21:41575792-41575814 AGCAAGATTGTATCCTTTGCAGG + Intergenic
1179720836 21:43315330-43315352 AGGAAGAGGGCAGCACTTGCGGG + Intergenic
1180483580 22:15776290-15776312 AGGAAGAGTGCACCCTAGGCTGG - Intergenic
1182266042 22:29116117-29116139 AGAAAGATTGTGGCCTTGGCAGG - Intronic
1182956222 22:34429182-34429204 GGTATGAGTGTTGCCTTTGCAGG - Intergenic
950498695 3:13350082-13350104 GGGATGACTGTGGCCTTTGCAGG - Intronic
953179346 3:40581914-40581936 AGGGTGGGTGTTGCCTTTGCAGG + Intergenic
956023496 3:64957551-64957573 AGGAAAAAGGTAGCCTTTGAAGG - Intergenic
960432200 3:117582803-117582825 AGAAAGAGTGTATTCTTTGGAGG + Intergenic
964295548 3:155229055-155229077 AGGAAGAGGGTAGAGTTGGCCGG + Intergenic
964655970 3:159066542-159066564 AGGAAGAGTCTAACCTTCACAGG - Intronic
966368926 3:179225330-179225352 AGGAAGAGTGTAGTCTGCTCAGG + Intronic
968271433 3:197406493-197406515 AGGAAGCGTGTAGACAGTGCTGG - Intergenic
969661779 4:8534282-8534304 AGGGAGAGTGGAGCATGTGCTGG + Intergenic
972978352 4:44664266-44664288 AGGCAGAGTTTAGTGTTTGCGGG - Intronic
973761358 4:54118904-54118926 AGGTACACTGTAGACTTTGCAGG + Intronic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
975026055 4:69550149-69550171 AGTAAGATTGTTCCCTTTGCTGG + Intergenic
976580974 4:86736947-86736969 AGCAAAAGTGTAGCCTTAGAAGG - Intronic
977989965 4:103429581-103429603 GGGAAGAGCGTGGCCTCTGCTGG + Intergenic
981031210 4:140127516-140127538 TGGAAGAGTCGAGCTTTTGCTGG - Intronic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982189764 4:152842254-152842276 ACAAAGAGGGTAGCCATTGCTGG - Intronic
983921076 4:173345652-173345674 AGGAAGAGGGCAGGCTATGCAGG - Intergenic
984488754 4:180405562-180405584 AGGCATAGTGAAGCCATTGCAGG + Intergenic
985283576 4:188311560-188311582 AGGCAGAGTGTAGAGTATGCTGG + Intergenic
986773268 5:10992602-10992624 AGGAGGAGTAGGGCCTTTGCCGG + Exonic
987214630 5:15721451-15721473 AGGAAAAGTTTAGTCTTTGTGGG + Intronic
990437775 5:55810605-55810627 TGGAAAAGTGTAGTCTTTTCTGG + Intronic
993032472 5:82721086-82721108 AGGAAGAGTCTAGGATTAGCAGG - Intergenic
994103556 5:95920684-95920706 AGGAAGAGTGGAGCAGTTGAAGG - Intronic
995612639 5:113926379-113926401 AAAAAGAGTGTGTCCTTTGCAGG + Intergenic
995741365 5:115359142-115359164 CGAAAGAGGGTAGCCCTTGCTGG + Intergenic
998023321 5:138790013-138790035 AGGAAAAGTGGAGTTTTTGCAGG + Intronic
999302686 5:150500892-150500914 TGGAAGAGTGTGGCCTTGCCTGG - Intronic
1000987059 5:167872577-167872599 AGAAAGAGTATACCATTTGCTGG + Intronic
1001108950 5:168879396-168879418 AGGAGGAGTGTTTCCTTAGCAGG + Intronic
1002314525 5:178334429-178334451 ACGAAGAGGGTGGCCTGTGCCGG - Intronic
1002868765 6:1147261-1147283 AGGAAGTGTGGAGCCCTGGCGGG - Intergenic
1004319879 6:14624075-14624097 GGGAAGGGCGTAGGCTTTGCAGG - Intergenic
1006660581 6:35639568-35639590 AGAAACAGTGGAGACTTTGCAGG - Intronic
1006718818 6:36136942-36136964 GGAAAGATTGTATCCTTTGCTGG + Exonic
1006869523 6:37238583-37238605 AGGAAGACTTTTGCCTTTCCTGG + Intronic
1009472145 6:64040771-64040793 ATGAATATTTTAGCCTTTGCAGG - Intronic
1012618000 6:101301822-101301844 AGGAAGAATGTAGCATTTGAAGG - Intergenic
1013054165 6:106567251-106567273 CGGCAGAGTGTAGGGTTTGCTGG + Intronic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1015884025 6:137897749-137897771 AGGACGTGTGTAGCTTGTGCTGG - Intergenic
1019297657 7:286986-287008 AGGAAAAGTGTCTGCTTTGCTGG - Intergenic
1020466584 7:8486469-8486491 AAGAAGAATGTATCCTTTGAGGG - Intronic
1021673112 7:23052281-23052303 AGTAAGATTTTAGGCTTTGCAGG + Intergenic
1022660221 7:32360080-32360102 AGGGAGAGTCTGGCCTTTGCTGG - Intergenic
1024685292 7:51737961-51737983 CAGAGGAGTGAAGCCTTTGCTGG - Intergenic
1027911342 7:84255388-84255410 TGAAAGAGTGTTGCCTTTGGGGG - Intronic
1028590976 7:92494241-92494263 GGAAAGAGTGTAGCATTTGTTGG + Intronic
1032626461 7:133596782-133596804 AGAAAGAGATGAGCCTTTGCTGG - Intronic
1034733404 7:153407511-153407533 AGAGAGAGTGTAGGCTTTGTGGG + Intergenic
1035304298 7:157921223-157921245 ATGCAGTGTGTAGCCTTTCCAGG - Intronic
1036137613 8:6176167-6176189 AGCAAGATTGCAGCCTCTGCTGG - Intergenic
1037107870 8:15131740-15131762 AGGAGGAGTTTGGCCTTTGGTGG - Intronic
1038222372 8:25622918-25622940 GGGAAGACTGTAGACTTTGGAGG - Intergenic
1039494244 8:37968873-37968895 AGGAAGAGGGAAGCCTCTGGTGG - Intergenic
1041452447 8:58020947-58020969 AGGAAGAAAGTAGCCTTTTCTGG - Intronic
1042711644 8:71723918-71723940 AGGAAAATTGTGGCTTTTGCAGG - Intergenic
1045223231 8:100218889-100218911 AGGCAGAGTGTAGGCTTTTGAGG + Intronic
1046504296 8:115117250-115117272 GGGAAGAATATAGCCTTTGGAGG - Intergenic
1047181031 8:122588318-122588340 AGAAAGAGTGTAGTGGTTGCTGG - Intergenic
1047201979 8:122775024-122775046 AGGAAGAGGGAAGCCATTCCAGG + Intergenic
1048616363 8:136079897-136079919 TGGAATAATGTAGCCTTTCCAGG + Intergenic
1048858296 8:138702883-138702905 AGTAAGAGTGTGGGCTTTGAGGG - Intronic
1053408071 9:37894933-37894955 AGCAAGATTGTGCCCTTTGCTGG - Intronic
1055431357 9:76247358-76247380 CCAAAGAGTGTAGCCGTTGCTGG + Intronic
1057304076 9:93902458-93902480 AGAAAGAGTGGAGCCTTCGAGGG - Intergenic
1058912005 9:109529505-109529527 AGGAATAAAGGAGCCTTTGCTGG - Intergenic
1060172980 9:121476836-121476858 AGGTAGAGTGTTGCCTTGCCTGG + Intergenic
1061936053 9:133858241-133858263 AGGATCAGTGTGGCCTCTGCAGG + Intronic
1062730420 9:138105360-138105382 TGTAGGAGTGTAGCCTTGGCTGG - Intronic
1203522096 Un_GL000213v1:54203-54225 AGGAAGAGTGGACCCTAGGCTGG + Intergenic
1188444251 X:30240058-30240080 AGGAAGAGGGTGGCCTTATCTGG - Intergenic
1188678243 X:32969493-32969515 AGGAAGAAGGTAGACTTTGATGG - Intronic
1189848343 X:45156561-45156583 GGGAAGAGTGTGGCCTTTGAGGG + Intronic
1189954296 X:46262138-46262160 GGAAAGAGGGTAGCCGTTGCTGG + Intergenic
1195371164 X:104174989-104175011 AGGAAGAGTGGGGCCATTGCAGG - Intronic
1195882023 X:109602246-109602268 AGGCAGATTATAGCCATTGCTGG + Intergenic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196768587 X:119271879-119271901 GTGAAGAGAGTGGCCTTTGCTGG - Intergenic
1198384242 X:136113457-136113479 AGGATGAGTGCAGCTTTTCCTGG - Intergenic
1199750693 X:150814847-150814869 AGGAAGAGGTAAGTCTTTGCTGG - Exonic
1199769871 X:150968270-150968292 ACCAAGAGAGTTGCCTTTGCTGG - Intergenic
1199788312 X:151125976-151125998 AGGAAGATCGTGTCCTTTGCAGG + Intergenic