ID: 912682685

View in Genome Browser
Species Human (GRCh38)
Location 1:111739162-111739184
Sequence TAAGAGCGAAGCTGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912682685_912682689 -6 Left 912682685 1:111739162-111739184 CCCCGGCGCCAGCTTCGCTCTTA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 912682689 1:111739179-111739201 CTCTTACCAGCTCCTGTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 166
912682685_912682691 0 Left 912682685 1:111739162-111739184 CCCCGGCGCCAGCTTCGCTCTTA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 912682691 1:111739185-111739207 CCAGCTCCTGTTTGAGGCGACGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912682685 Original CRISPR TAAGAGCGAAGCTGGCGCCG GGG (reversed) Intronic
901540280 1:9910695-9910717 TAAGGCTGAAGCTGGCGCTGCGG + Intergenic
901838505 1:11939244-11939266 TAAGTGGGCAGCTGGCCCCGGGG + Intronic
902461840 1:16583495-16583517 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
902462620 1:16589800-16589822 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
912682685 1:111739162-111739184 TAAGAGCGAAGCTGGCGCCGGGG - Intronic
913543292 1:119842335-119842357 TAAGAGCTAAGCTGGGCCAGGGG - Intergenic
913604364 1:120451358-120451380 TAAGAGCTAAGCTGGGCCAGGGG + Intergenic
913640464 1:120807786-120807808 TAAGAGCTAAGCTGGGCCAGGGG + Intronic
913641237 1:120814070-120814092 TAAGAGCTAAGCTGGGCCAGGGG + Intronic
913990705 1:143609238-143609260 TAAGAGCTAAGCTGGGCCAGGGG - Intergenic
914084178 1:144437846-144437868 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
914190199 1:145403117-145403139 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
914277247 1:146136254-146136276 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
914278012 1:146142551-146142573 TAAGAACGAAGCTGGGCCAGGGG - Intronic
914364793 1:146968627-146968649 TAAGAGCTAAGCTGGGCCAGGGG + Intronic
914365555 1:146974918-146974940 TAAGAGCTAAGCTGGGCCAGGGG + Intronic
914486887 1:148118521-148118543 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
914487647 1:148124800-148124822 TAAGAACGAAGCTGGGCCAGGGG - Intronic
914539059 1:148593499-148593521 TAAGAACGAAGCTGGGCCAGGGG - Intronic
914587219 1:149073669-149073691 TAAGAGCTAAGCTGGGCCAGGGG - Intronic
914587995 1:149079954-149079976 TAAGAACGAAGCTGGGCCAGGGG - Intronic
914627621 1:149478125-149478147 TAAGAACGAAGCTGGGCCAGGGG + Intergenic
914940694 1:152020416-152020438 TAAGAGCTAAGCTGGGCCAGGGG + Intergenic
1066618898 10:37323657-37323679 TAAGAGCAAAGCTGGAGGAGTGG - Intronic
1067350550 10:45472030-45472052 TAAGAGCGAACCCTGAGCCGCGG + Intronic
1069814749 10:71186694-71186716 GAAGAGCGAGGCTGGCCCAGGGG - Intergenic
1084542650 11:69797185-69797207 AAAGAGCCAGCCTGGCGCCGTGG - Intergenic
1085220709 11:74871691-74871713 TAAGAGTGAAGCTGGGGGAGTGG - Intronic
1115959227 14:38816374-38816396 TAAGAGCTAAGCTCGCCCTGAGG - Intergenic
1130096323 15:80858955-80858977 TAAGAGTGAAGCTTGCACAGGGG - Intronic
1137754071 16:50887708-50887730 AAAGAAGGAAGCTGGGGCCGAGG + Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1151322724 17:73361389-73361411 AAAGAACGAAGCAGGCGCAGTGG + Intronic
924997796 2:379833-379855 AAAGGGCTAGGCTGGCGCCGTGG + Intergenic
933722740 2:85408804-85408826 GAAGAGGGGAGCTGGGGCCGGGG + Intronic
936013787 2:108942714-108942736 TGGGAGCGAAGCTGGCTTCGTGG - Intronic
938310458 2:130285648-130285670 TGGGAGCGATGCTGGAGCCGAGG + Intergenic
940990047 2:160087564-160087586 TAAGAGCGAAGCTGGGAGGGTGG + Intergenic
942706899 2:178784153-178784175 CAAGAGTGAAGCTGGCGTTGAGG - Exonic
948822751 2:240558141-240558163 TAAGCGGGAGGCTGGCACCGAGG - Intronic
1173784678 20:45784075-45784097 TAAGGGCGAGGCTGGCACCCAGG - Intronic
1180698827 22:17770805-17770827 TCATAGCCATGCTGGCGCCGGGG - Intronic
1184032594 22:41903787-41903809 TCAGAGCGAGGCTGCTGCCGTGG + Intronic
1185077550 22:48691417-48691439 TAAGAGGGAAGATGGAGACGTGG + Intronic
961389383 3:126543137-126543159 TGAGACCGAAGGTGGCGCCTGGG - Exonic
966688800 3:182723558-182723580 TAGGAGTGAAGCTGGGGCAGTGG + Intergenic
971592103 4:28481159-28481181 TAAGATGTAGGCTGGCGCCGTGG - Intergenic
975113167 4:70649504-70649526 TAAGAGTAAAGCTGGCGGCCGGG - Intronic
985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG + Intronic
986371172 5:7081587-7081609 TAAGAGGGAGGCTGGAGCAGTGG + Intergenic
989164643 5:38422402-38422424 GAAGAGAGAACCTGGCGGCGAGG - Intronic
991640504 5:68747044-68747066 TTAGAGCGAAGCTGGGGGCAGGG - Intergenic
1002045196 5:176537508-176537530 TAAGTGCGAAGGTGGGGGCGAGG - Intronic
1002069440 5:176670628-176670650 TAAGAGACAAGCTGGTGCTGAGG - Intergenic
1004522430 6:16374715-16374737 ATAGAGCGAAGCTGGGGCCTGGG + Intronic
1007768724 6:44176944-44176966 TACGAGGGCAGCTGGCGCAGAGG + Exonic
1018613009 6:165662046-165662068 CGAGGGCGAAGCTGGCGCCCTGG + Exonic
1019431317 7:1001108-1001130 ATGGAGCGAAGCTGGCGCTGTGG + Intronic
1023382463 7:39623118-39623140 TCAGAGCGGAGCTGGCGACGTGG - Intergenic
1024467967 7:49733469-49733491 TAAGAGAGAAGCTGGTGGCTAGG + Intergenic
1035332662 7:158106436-158106458 TAAGAAAGAAGCTGGAGCCAAGG - Intronic
1036176420 8:6542477-6542499 TAAGAGGGACGCTAGCGCCTGGG + Intronic
1047697296 8:127416151-127416173 TGAGAGCGAAGCAGGAGTCGGGG + Exonic
1055391879 9:75830830-75830852 TAAGATGGAAACTGGGGCCGTGG - Intergenic