ID: 912684132

View in Genome Browser
Species Human (GRCh38)
Location 1:111748798-111748820
Sequence GAGCCTCGGTGGTGACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912684132_912684135 12 Left 912684132 1:111748798-111748820 CCTCAGTGTCACCACCGAGGCTC 0: 1
1: 0
2: 2
3: 14
4: 163
Right 912684135 1:111748833-111748855 GACAATTACTTCTTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912684132 Original CRISPR GAGCCTCGGTGGTGACACTG AGG (reversed) Intronic
900237924 1:1601267-1601289 GAGGCTGGGTGGTGACTCCGTGG - Intergenic
901033605 1:6322828-6322850 AAGCCTCGGAAATGACACTGGGG + Intronic
901671425 1:10858347-10858369 GTGCCTGGGAGGGGACACTGGGG + Intergenic
903792313 1:25902790-25902812 GAGCCTCAGTGCTTACACTAAGG - Intronic
904422685 1:30404374-30404396 GGCCCTCGCTGGTGACACTGGGG + Intergenic
905321184 1:37118600-37118622 GAGCCAGGGTGGAGACAGTGTGG + Intergenic
909073949 1:71030268-71030290 GAGTCACCGTGGTCACACTGAGG + Intronic
911638826 1:100266119-100266141 GAGCCGCGCTGGGAACACTGCGG - Intergenic
912684132 1:111748798-111748820 GAGCCTCGGTGGTGACACTGAGG - Intronic
914918358 1:151831730-151831752 GAGGCTCGGTGCTGTCTCTGTGG + Exonic
915577207 1:156787250-156787272 CAGCCTCTGTGGTGTCACTTTGG + Intronic
915612007 1:157001410-157001432 GATCCTGGGTGATGAAACTGTGG - Intronic
915634113 1:157174418-157174440 AAGCCTCGGTGGTCTCACTGGGG - Intergenic
917648155 1:177048781-177048803 GAGACTCGCTGGAGACACAGAGG + Intronic
921601561 1:217111652-217111674 GAGCCTCTGTGGTTTCACAGTGG - Intronic
922182841 1:223249056-223249078 GAGCCACAGTGGCTACACTGAGG + Intronic
923773005 1:236953906-236953928 GAGGCTCTGTTGTGACACTGAGG + Intergenic
1064706401 10:18076841-18076863 GAGCCGAGATGGTGCCACTGTGG - Intergenic
1066369929 10:34811916-34811938 GAGCCTCGCTGAGGACAGTGCGG - Intronic
1067572475 10:47381526-47381548 GAGGCTGGCTGGTGGCACTGGGG + Intronic
1070467306 10:76736489-76736511 AAGCTACGGTGGTGACTCTGTGG + Intergenic
1071290221 10:84183722-84183744 GAGCCTGGGAGGTGAGGCTGTGG - Intronic
1075721585 10:124590652-124590674 GAGCCTTGTTGGTGCCACTGTGG - Intronic
1076824502 10:132960310-132960332 GAGCCTCGGTGCTGAGTCGGGGG - Intergenic
1077216370 11:1396812-1396834 GTGCCTAGATGGTGGCACTGTGG + Intronic
1078427223 11:11261721-11261743 GAGCCTCCAGGGTGAGACTGGGG - Intergenic
1078896898 11:15604860-15604882 GACCCTCCCTGGTGCCACTGAGG + Intergenic
1082846385 11:57729012-57729034 ACGACTCAGTGGTGACACTGTGG + Intronic
1083222113 11:61259217-61259239 GAGCCTGCATGGAGACACTGAGG - Exonic
1083333977 11:61912299-61912321 CAGCCTTTGCGGTGACACTGAGG + Intronic
1084448382 11:69217774-69217796 GAGCCTAGGTGGGGTCACTCAGG + Intergenic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1088040495 11:105375564-105375586 GTGCCTCACTGGGGACACTGTGG + Intergenic
1089256961 11:117199223-117199245 GAGCCTGTGTGGAGTCACTGGGG + Intergenic
1091907825 12:4203111-4203133 CAGCCTAGTTGGTGTCACTGAGG - Intergenic
1092183415 12:6461638-6461660 GAGCCACGGGGGTGCCTCTGAGG - Intronic
1092308485 12:7325888-7325910 GAGCCTCTGTAGTGACACTGTGG + Intronic
1102815644 12:115863577-115863599 GAGCCTTGGTGTACACACTGTGG - Intergenic
1105354226 13:19643865-19643887 AGGTCTCTGTGGTGACACTGTGG - Intronic
1106593513 13:31118067-31118089 GGGCCTTGATGGTGAAACTGGGG - Intergenic
1109580322 13:64322901-64322923 GACACTCTGTGGAGACACTGTGG - Intergenic
1111819906 13:93199836-93199858 GAGCCATGATCGTGACACTGAGG + Intergenic
1113521771 13:110946643-110946665 AAGCCCCGGAGGTGACAGTGGGG - Intergenic
1113779704 13:112969112-112969134 GACCCGCGGTGGTGACACACCGG + Intronic
1113897553 13:113775759-113775781 AGGCCTCGGTGGTGAGGCTGTGG - Intronic
1114423311 14:22602524-22602546 GAGCCTCGGGTGAGAGACTGAGG - Intronic
1114657624 14:24325560-24325582 GAGCCTGGGCGGTGAGGCTGAGG - Intronic
1121736598 14:96222230-96222252 GAGCTTCGGTGCTGTCTCTGGGG + Intronic
1122548443 14:102537678-102537700 AGGCCTCAGTGGAGACACTGTGG - Intergenic
1126264820 15:46741845-46741867 CAGCCTCGCTGGTGACACCCAGG + Intergenic
1128662478 15:69512596-69512618 GTGCCTCTCTGGTGACAATGAGG - Intergenic
1129376941 15:75139502-75139524 GAGCCTTGGTGCTCTCACTGGGG - Intergenic
1130995870 15:88903810-88903832 GCTCCTAGGTGATGACACTGCGG + Intronic
1132701543 16:1224311-1224333 GGGCCACGGTGGGGACGCTGTGG + Intronic
1132814232 16:1818274-1818296 GAGCCTGGGTGGTGCCGGTGTGG - Intronic
1132900791 16:2253030-2253052 AAGCATCGGAGGTGCCACTGCGG + Intergenic
1135233361 16:20730551-20730573 GAGCCTCTGCAGTGACACTATGG + Intronic
1135691279 16:24539801-24539823 GAGCCTCGGCGGTGTCCCCGGGG + Intronic
1137954739 16:52817728-52817750 GATCCCAGGGGGTGACACTGAGG + Intergenic
1138413342 16:56856621-56856643 GAGCCTGGGAGGTGAGGCTGTGG + Intergenic
1141525860 16:84611177-84611199 GAGCATCAGTGGTGAGGCTGGGG - Intronic
1142015901 16:87747168-87747190 GTGCCTCTGTGGTGACTCTGTGG - Intronic
1142315113 16:89338971-89338993 GGCCCTCGGTGGTGACTTTGAGG - Intronic
1143369429 17:6429236-6429258 GAGCCTAGTTGGGGAAACTGAGG - Intronic
1143552625 17:7640348-7640370 GAGCCAAGGTCGTGCCACTGCGG - Intergenic
1143694509 17:8602027-8602049 GAGCCGAGATCGTGACACTGTGG - Intronic
1147833636 17:43314721-43314743 GAGCCTCGGCCCTGGCACTGTGG - Intergenic
1148104605 17:45112646-45112668 GAGCGTGGCTGGTGACAGTGAGG + Exonic
1151659194 17:75509731-75509753 GAGCCCCAGTGGAGACAATGCGG + Intronic
1152217327 17:79041374-79041396 GAGCCTCCGAGGTGACAGTGAGG - Intronic
1152365803 17:79855658-79855680 CAGCCTTGATGGTGACCCTGGGG + Intergenic
1156462019 18:37326512-37326534 GGGCCTCCATGGGGACACTGAGG - Intronic
1157608686 18:48942324-48942346 ATGCATCGGTGGTGACATTGTGG - Intronic
1158538151 18:58327149-58327171 GAGCCGAGATGGTGCCACTGTGG - Intronic
1161091729 19:2363622-2363644 GACCCTGGGTGCCGACACTGGGG + Intergenic
1161339038 19:3730582-3730604 GAGCCCAGGTGGTGGCTCTGAGG + Exonic
1161707652 19:5829577-5829599 GAGCCTGGGAAGGGACACTGTGG - Intergenic
1162986403 19:14273032-14273054 GGGCCTCTGTTGTGAAACTGAGG - Intergenic
1163539898 19:17902121-17902143 GAGCCTCAGTTGTGCCACTTCGG + Intergenic
1164502183 19:28829297-28829319 GAGCCTGCCTGGTGACCCTGAGG + Intergenic
1166268025 19:41696910-41696932 CTGCCTGGGTGGGGACACTGGGG - Intronic
1167082193 19:47284203-47284225 CAGCCTGGGTGGTGACAGCGAGG + Intergenic
928075846 2:28263795-28263817 GAGCATCAGAGGTAACACTGGGG - Intronic
929533698 2:42767651-42767673 GCTCCTCGGTGGTGACAATGGGG - Exonic
931015999 2:57981576-57981598 CAACCTCTGTGGTGAGACTGAGG + Intronic
932490801 2:72119005-72119027 GATCCTCAGAGTTGACACTGTGG - Intergenic
932830560 2:74985587-74985609 GACCCTGAGTGGGGACACTGAGG - Intergenic
934719202 2:96561519-96561541 GAGCATCGCTGGGGACAGTGTGG + Intergenic
936548320 2:113412082-113412104 GAGCCTCAGGGCTGACAATGGGG + Intergenic
936840239 2:116759172-116759194 GAGCATCATTGGTGACAATGTGG - Intergenic
937246785 2:120498946-120498968 GAGCCTGGCAGGGGACACTGTGG - Intergenic
937297553 2:120818684-120818706 GGGCCTGGGCGGAGACACTGGGG - Intronic
946429259 2:219615943-219615965 GAGCCAAGGTGGAGACAGTGAGG + Intronic
946459731 2:219858142-219858164 GCTCCTCTGTGGTGACTCTGGGG + Intergenic
946469056 2:219939672-219939694 GAGCCTTGGTGGTGTCCCTATGG + Intergenic
948724304 2:239922337-239922359 GAGACTGGGTGGTGGCATTGAGG - Intronic
1174170883 20:48617633-48617655 GGGCATCGGTGGTGACACTGAGG + Intergenic
1175709832 20:61210580-61210602 GGGCCTCTATAGTGACACTGAGG - Intergenic
1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG + Intergenic
1180169482 21:46050452-46050474 GAGCCAGGCTGGTGACACTGGGG + Intergenic
1180706823 22:17815381-17815403 CTGCCTCAGTGGTGACAGTGTGG - Intronic
1181493175 22:23273505-23273527 GAGAGACTGTGGTGACACTGAGG + Intronic
1184256257 22:43288770-43288792 GAGGCTGGGTTGTGACGCTGAGG - Intronic
1184675581 22:46040945-46040967 GAGAGTGGGGGGTGACACTGAGG - Intergenic
950456469 3:13095619-13095641 GTGGCTCGGTGGGGACGCTGAGG + Intergenic
952185215 3:30961083-30961105 GAGCCTCGGTTAGGACAGTGTGG - Intergenic
952414315 3:33076514-33076536 GGCCCACGGTGGTGACAATGAGG + Intronic
952429980 3:33213873-33213895 AAGCCTTGGTGGTGCAACTGGGG + Intronic
952530489 3:34257524-34257546 GAGCCTTGGTGGTCAGAATGAGG + Intergenic
952868740 3:37877943-37877965 GATCCTCAGTGTTGACAGTGGGG - Intronic
953198225 3:40753939-40753961 GGGCCTCGGTGCTCACACTTGGG - Intergenic
953845867 3:46425752-46425774 GTGCCTCGGTGCTGATGCTGGGG - Intergenic
954480175 3:50792346-50792368 GAGCTTTGGGGCTGACACTGTGG + Intronic
963110387 3:141683375-141683397 CAGCCTCAGTGGAGACAGTGAGG - Intergenic
963803313 3:149698547-149698569 GTGCCCTGGTGGGGACACTGTGG + Intronic
964401095 3:156299368-156299390 GAGCCTCTGTGGCAGCACTGTGG - Intronic
966625941 3:182017240-182017262 GTTCCTCAGTGGTGACAGTGGGG - Intergenic
968546724 4:1202700-1202722 TAGCCTCGGTGGGGACTCCGAGG + Intronic
970492184 4:16585561-16585583 GTGCCTGGGTGGAGGCACTGGGG + Intronic
976612594 4:87045349-87045371 GACCCTTGGTGCTGACAATGAGG + Intronic
977420381 4:96792183-96792205 GATGGTCGGTGGTGACACTGAGG + Intergenic
984806781 4:183758523-183758545 GAGCCTCGGTGGGAAGGCTGGGG + Intergenic
987006826 5:13718978-13719000 GAGCCTCGGTGGTCATCCAGAGG + Exonic
987023776 5:13902381-13902403 GAGCCTGGGGGGTGGCACTGGGG + Intronic
988076264 5:26359601-26359623 GAGCTTCGGGGCTGAGACTGTGG + Intergenic
993729835 5:91409549-91409571 GAGCCTTGGTGGTGACTCCAGGG - Intergenic
998251674 5:140557587-140557609 GAGCCGCTGTGGGGACCCTGCGG + Exonic
999696372 5:154191118-154191140 GAGTCTCGGAGCTGACTCTGAGG - Intronic
1000876021 5:166639151-166639173 GAGCCTGGGAGGTGACACCAAGG - Intergenic
1001052141 5:168422153-168422175 GAGCCTGGGCTGGGACACTGGGG - Intronic
1001268128 5:170289988-170290010 GAGCCTGGCTGGAGACACAGAGG + Intronic
1003707972 6:8555932-8555954 GAGTCTATGTGGTGCCACTGAGG - Intergenic
1004720043 6:18261060-18261082 GAGCCTTGGTGGTGAATCTAGGG - Intronic
1007289522 6:40774834-40774856 GAGCCCAAGTGGAGACACTGAGG - Intergenic
1017647785 6:156555098-156555120 GACCCTCGGGGGTGGCAGTGAGG - Intergenic
1019347655 7:538661-538683 GGGCCTAGGAGGGGACACTGAGG - Intergenic
1022843792 7:34190341-34190363 GAGCCCCCGTGGTGACACCCTGG - Intergenic
1026654653 7:72246471-72246493 TAGCCTGGCAGGTGACACTGGGG - Intronic
1027651417 7:80873208-80873230 GAGCCACTGTGGTGAGACTGTGG + Intronic
1028247604 7:88499886-88499908 CAGCCTCTGTGGTGACACAGAGG - Intergenic
1029495299 7:100893197-100893219 GGGCCTCTGGGGTGTCACTGAGG + Exonic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1033560866 7:142529172-142529194 GAGGCTCAGTGATGTCACTGTGG + Intergenic
1034898656 7:154893785-154893807 GAGCCTGCATGCTGACACTGTGG + Intronic
1036263057 8:7255390-7255412 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036265656 8:7270635-7270657 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036266958 8:7278257-7278279 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036268264 8:7285879-7285901 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036269568 8:7293501-7293523 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036298326 8:7553554-7553576 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036299631 8:7561204-7561226 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036300935 8:7568850-7568872 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036302242 8:7576500-7576522 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036303532 8:7584144-7584166 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036315096 8:7713930-7713952 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036316404 8:7721576-7721598 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036317711 8:7729224-7729246 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036319020 8:7736872-7736894 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036320328 8:7744519-7744541 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036321636 8:7752167-7752189 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036322946 8:7759815-7759837 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036324248 8:7767464-7767486 GAGTCTCCTTGATGACACTGAGG + Intergenic
1036351792 8:8016843-8016865 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036353093 8:8024489-8024511 GAGTCTCCTTGATGACACTGAGG - Intergenic
1036354386 8:8032136-8032158 GAGTCTCCTTGATGACACTGAGG - Intergenic
1044749279 8:95400712-95400734 GAGCCTAAGAGCTGACACTGGGG - Intergenic
1045652206 8:104351856-104351878 GAGCCTCTGTCATGACCCTGTGG - Intronic
1048915874 8:139182261-139182283 GTGCCTCAGTGGGGACTCTGTGG - Intergenic
1049801204 8:144518189-144518211 GAGCCTGGGAGGTGCCACCGCGG + Intronic
1053727243 9:41016705-41016727 GAGCCTCAGGGCTGACAATGGGG - Intergenic
1054701273 9:68415407-68415429 GAGCCTCAGGGCTGACAATGGGG + Intronic
1055290894 9:74780673-74780695 GAGGCTCTGTGGTAACAGTGGGG + Intronic
1056779992 9:89542047-89542069 GAGCATCTGTGGTGGGACTGAGG + Intergenic
1060004383 9:119986673-119986695 GTGCCTGGGTGCTGACCCTGGGG - Intergenic
1060601248 9:124879480-124879502 CAGCCTCGATGGAGACACTGGGG - Exonic
1060784575 9:126440320-126440342 TAGCCTTGGCGGTGGCACTGGGG + Intronic
1188809691 X:34638048-34638070 GAGTATCTGTGGTGATACTGTGG + Intronic
1199518008 X:148700511-148700533 GAGCCTCGGTCCTGGCACTGAGG + Intronic
1200138757 X:153886995-153887017 GAGCCTAGGAGGGGGCACTGGGG - Intronic
1202115260 Y:21465656-21465678 GGGCCTCGGTGGTGTCTCAGTGG - Intergenic