ID: 912686535 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:111771958-111771980 |
| Sequence | ATTTCCAGGGTGGTGACGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 141 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 137} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912686535_912686544 | 27 | Left | 912686535 | 1:111771958-111771980 | CCCCACGTCACCACCCTGGAAAT | 0: 1 1: 0 2: 0 3: 3 4: 137 |
||
| Right | 912686544 | 1:111772008-111772030 | CAGAGCAGTGCAATATAATGTGG | 0: 1 1: 0 2: 1 3: 17 4: 170 |
||||
| 912686535_912686545 | 30 | Left | 912686535 | 1:111771958-111771980 | CCCCACGTCACCACCCTGGAAAT | 0: 1 1: 0 2: 0 3: 3 4: 137 |
||
| Right | 912686545 | 1:111772011-111772033 | AGCAGTGCAATATAATGTGGAGG | 0: 1 1: 1 2: 1 3: 11 4: 120 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912686535 | Original CRISPR | ATTTCCAGGGTGGTGACGTG GGG (reversed) | Intronic | ||