ID: 912686535

View in Genome Browser
Species Human (GRCh38)
Location 1:111771958-111771980
Sequence ATTTCCAGGGTGGTGACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912686535_912686545 30 Left 912686535 1:111771958-111771980 CCCCACGTCACCACCCTGGAAAT 0: 1
1: 0
2: 0
3: 3
4: 137
Right 912686545 1:111772011-111772033 AGCAGTGCAATATAATGTGGAGG 0: 1
1: 1
2: 1
3: 11
4: 120
912686535_912686544 27 Left 912686535 1:111771958-111771980 CCCCACGTCACCACCCTGGAAAT 0: 1
1: 0
2: 0
3: 3
4: 137
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912686535 Original CRISPR ATTTCCAGGGTGGTGACGTG GGG (reversed) Intronic