ID: 912686535 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:111771958-111771980 |
Sequence | ATTTCCAGGGTGGTGACGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 141 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 137} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912686535_912686545 | 30 | Left | 912686535 | 1:111771958-111771980 | CCCCACGTCACCACCCTGGAAAT | 0: 1 1: 0 2: 0 3: 3 4: 137 |
||
Right | 912686545 | 1:111772011-111772033 | AGCAGTGCAATATAATGTGGAGG | 0: 1 1: 1 2: 1 3: 11 4: 120 |
||||
912686535_912686544 | 27 | Left | 912686535 | 1:111771958-111771980 | CCCCACGTCACCACCCTGGAAAT | 0: 1 1: 0 2: 0 3: 3 4: 137 |
||
Right | 912686544 | 1:111772008-111772030 | CAGAGCAGTGCAATATAATGTGG | 0: 1 1: 0 2: 1 3: 17 4: 170 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912686535 | Original CRISPR | ATTTCCAGGGTGGTGACGTG GGG (reversed) | Intronic | ||