ID: 912686544

View in Genome Browser
Species Human (GRCh38)
Location 1:111772008-111772030
Sequence CAGAGCAGTGCAATATAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912686534_912686544 28 Left 912686534 1:111771957-111771979 CCCCCACGTCACCACCCTGGAAA 0: 1
1: 0
2: 1
3: 15
4: 165
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686536_912686544 26 Left 912686536 1:111771959-111771981 CCCACGTCACCACCCTGGAAATC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686542_912686544 4 Left 912686542 1:111771981-111772003 CCAGGTATGAAAAATATAAGCAA 0: 1
1: 1
2: 2
3: 27
4: 404
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686537_912686544 25 Left 912686537 1:111771960-111771982 CCACGTCACCACCCTGGAAATCC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686540_912686544 14 Left 912686540 1:111771971-111771993 CCCTGGAAATCCAGGTATGAAAA 0: 1
1: 0
2: 1
3: 20
4: 273
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686541_912686544 13 Left 912686541 1:111771972-111771994 CCTGGAAATCCAGGTATGAAAAA 0: 1
1: 0
2: 1
3: 17
4: 317
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686539_912686544 17 Left 912686539 1:111771968-111771990 CCACCCTGGAAATCCAGGTATGA 0: 1
1: 0
2: 3
3: 16
4: 204
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170
912686535_912686544 27 Left 912686535 1:111771958-111771980 CCCCACGTCACCACCCTGGAAAT 0: 1
1: 0
2: 0
3: 3
4: 137
Right 912686544 1:111772008-111772030 CAGAGCAGTGCAATATAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912686544 Original CRISPR CAGAGCAGTGCAATATAATG TGG Intronic