ID: 912687365

View in Genome Browser
Species Human (GRCh38)
Location 1:111778025-111778047
Sequence TGGCTAAGGCTGCCAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912687360_912687365 11 Left 912687360 1:111777991-111778013 CCAAGTTGACTACAAATCTATGG No data
Right 912687365 1:111778025-111778047 TGGCTAAGGCTGCCAGAGTGAGG 0: 1
1: 0
2: 3
3: 12
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912687365 Original CRISPR TGGCTAAGGCTGCCAGAGTG AGG Intronic
902578331 1:17392506-17392528 TGGCTAAGGCTGTGAGAGCTGGG + Intronic
903300262 1:22373820-22373842 TGGCTAAGGATGTCAGAGCTGGG - Intergenic
907730751 1:57063029-57063051 TGGCTAAGGGTGCCTGAGAATGG + Intronic
907979677 1:59469367-59469389 TGGCAAAGGGTGCAAGAGTGTGG + Intronic
912687365 1:111778025-111778047 TGGCTAAGGCTGCCAGAGTGAGG + Intronic
914904574 1:151733383-151733405 AGGCTAAGGCTGGCAGAGTGAGG - Intergenic
915335116 1:155136401-155136423 TGGGAAAGGCTACCAGAGGGAGG + Intronic
915399848 1:155614111-155614133 TGGCCAAGGCTTCCAGGGTCTGG - Exonic
915417006 1:155749975-155749997 TGGCCAAGGCTTCCAGGGTCTGG - Exonic
915557112 1:156666925-156666947 TAGGTAAAGCTGCCTGAGTGAGG + Intergenic
918238836 1:182604232-182604254 TGGGGAAGGCGGCCAGGGTGCGG + Exonic
920207893 1:204306381-204306403 TGGGTAAGGCTGGCTGAATGTGG - Intronic
920695787 1:208180447-208180469 TGGCTATGGCTGCCTGGGTATGG + Intronic
921223112 1:212988366-212988388 GAGCTAAGGCTGGCAGGGTGGGG + Intronic
922090718 1:222392734-222392756 TGGCTAAGGTTTGCAGTGTGGGG - Intergenic
922572123 1:226640397-226640419 TGTCGAAGGCAGCCACAGTGAGG - Intronic
924926765 1:248691656-248691678 TGGCCAAGGCTCCCAGAGGGCGG + Intergenic
1063949304 10:11207573-11207595 TGCCTCAGGCGGCCAGAGGGCGG + Intronic
1065699054 10:28406820-28406842 TGCCTCAGGCTCCCAAAGTGCGG + Intergenic
1067307010 10:45073274-45073296 CAGCTAAGGCTCCAAGAGTGTGG - Intergenic
1067362165 10:45592781-45592803 GAGCTAAGGCTGCCAGATTTAGG + Intronic
1070310746 10:75272003-75272025 TTCCTCAGGCTGCAAGAGTGTGG - Intergenic
1070409854 10:76129549-76129571 TGGCTAATGCTACAGGAGTGGGG + Intronic
1070794405 10:79208292-79208314 CGGCTGAGGCTCCAAGAGTGAGG - Intronic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1071828228 10:89346909-89346931 AGGCTAAGCCTGACTGAGTGTGG - Intronic
1071863414 10:89699765-89699787 TGGCTAAGGCTTACAGGGTCTGG + Intergenic
1073175108 10:101551032-101551054 GGGCTGAAGCTGCCACAGTGTGG + Intronic
1074283093 10:112071565-112071587 TGGGGAAGGTTGTCAGAGTGGGG - Intergenic
1074729610 10:116355800-116355822 TGCCTAGGGCTGGCAGAGTTAGG + Intronic
1075809683 10:125215959-125215981 TGCCCCAGGCAGCCAGAGTGGGG + Intergenic
1076187688 10:128461808-128461830 TGGATAAGGGAGGCAGAGTGGGG - Intergenic
1076687420 10:132204370-132204392 GGGCTCAGGCTGCCAGGGTCCGG + Intronic
1076723365 10:132402309-132402331 TGGCTACGACAGCCAGAGGGAGG - Intronic
1078547220 11:12255206-12255228 TGGTTAAGGCTGGCCGGGTGTGG - Intronic
1079889137 11:26028470-26028492 TGGCTCAGGGTGCTAAAGTGTGG + Intergenic
1081495551 11:43606372-43606394 TAGCTAAGGCTGCCATTTTGTGG + Intronic
1081815594 11:45938483-45938505 TAGCTAAGGCTCCCTGGGTGGGG + Intronic
1082928022 11:58571297-58571319 TGGCCCAGGCTGCTGGAGTGTGG - Intronic
1083463590 11:62831475-62831497 TGGCTCTGGCGGCCAGAGCGCGG + Intronic
1084085612 11:66853751-66853773 TGACTTAGAGTGCCAGAGTGTGG - Intronic
1086177482 11:83908979-83909001 TGTCTCAGCCTCCCAGAGTGTGG + Intronic
1088390150 11:109305301-109305323 GGGGTGAAGCTGCCAGAGTGTGG + Intergenic
1088618658 11:111659914-111659936 AAGCTGAGGCTGGCAGAGTGAGG - Intronic
1089516316 11:119034166-119034188 TGCCTCAGGCTCCCAAAGTGCGG + Intergenic
1089800602 11:121024126-121024148 GGGCTCCGGCGGCCAGAGTGGGG + Exonic
1091447182 12:550776-550798 TGGCTGAGGCTGCCAGCTGGAGG - Intronic
1093118306 12:15237792-15237814 TGGCTAAGTCTACCAGTCTGTGG - Intronic
1095649321 12:44588323-44588345 TGGCTCAGGCTGCCTCAGAGAGG - Intronic
1095987864 12:48011533-48011555 TGGCTAAGGATTCCAGAGTCGGG - Intergenic
1096430314 12:51537716-51537738 TGGCTCAGGCAGCCAGATCGAGG + Intergenic
1096815223 12:54197611-54197633 TGGCTAAGCCTGCTAGATTTTGG - Intergenic
1100509940 12:95260599-95260621 AGGCTAAAGCTGACAGAGAGTGG - Intronic
1100986749 12:100209075-100209097 TAGCTCAGGCTGCCAGTGTGAGG + Intronic
1101335076 12:103789749-103789771 GGGCTAACACTGCCAGGGTGAGG - Intronic
1104924672 12:132307920-132307942 TGGCTCAGCCTCCCAGTGTGCGG - Intronic
1105362391 13:19732676-19732698 TGCCTCAGGCTCCCAAAGTGTGG - Intronic
1109509266 13:63348235-63348257 TGACTAAGCCTGCCAAATTGTGG - Intergenic
1110682122 13:78326844-78326866 TGGATAAGGCAGCCAGACTGTGG - Intergenic
1115537490 14:34386778-34386800 TGACTTGAGCTGCCAGAGTGAGG - Intronic
1115555793 14:34544199-34544221 GGGCTGAGGCTGCCATTGTGGGG + Intergenic
1115558115 14:34558888-34558910 GGGCTGAGGCTGCCATTGTGGGG - Intergenic
1115768146 14:36645205-36645227 TTGATAAGGCTGCTAGAATGAGG - Intergenic
1116013983 14:39384663-39384685 TGGCTGAGTGTGCCGGAGTGAGG - Intronic
1116869013 14:50054300-50054322 TGGGAAAGGCTGACAGAGTGAGG - Intergenic
1117052220 14:51872565-51872587 TGGGTAAGGCTGTCAGTGAGAGG - Intronic
1118138570 14:63054628-63054650 TGGCTACAGATGCAAGAGTGAGG + Intronic
1121173818 14:91875636-91875658 AGGGTAAGGCTGGAAGAGTGAGG - Intronic
1122174271 14:99905629-99905651 TGGCTAAGGGTGACAGAATTAGG - Intronic
1123708404 15:22967426-22967448 TGGCTAAGTCTACAGGAGTGCGG + Intronic
1123960970 15:25399824-25399846 TGCCTCAGTCTCCCAGAGTGTGG + Intronic
1125679891 15:41523982-41524004 TGCCAAAGGGTGCCACAGTGAGG + Intronic
1126371728 15:47954301-47954323 TGGCTAAGCTGTCCAGAGTGTGG - Intergenic
1127497134 15:59523981-59524003 CTGGTAAGGCTCCCAGAGTGCGG - Intergenic
1129251755 15:74313019-74313041 AGGCTATGGGAGCCAGAGTGGGG - Intronic
1132029503 15:98428518-98428540 TGGGCAAGGCTGCCATCGTGTGG + Intergenic
1132393800 15:101457741-101457763 TGGCCAGGGCTGCCTGTGTGTGG - Intronic
1133667188 16:7979988-7980010 TGTGTCAGGGTGCCAGAGTGGGG - Intergenic
1134168308 16:11948078-11948100 TGGCAAAGGGAGGCAGAGTGGGG + Intronic
1135168538 16:20162826-20162848 TGGCCAAGGTTTCCAGAGAGAGG + Intergenic
1136180344 16:28547568-28547590 TGCCTAAGCCTCCCAAAGTGTGG - Intergenic
1141270370 16:82534507-82534529 TGGCTATGGATGCAAGAGTTTGG - Intergenic
1142123667 16:88399714-88399736 TGGTTCAGGCTGCAGGAGTGAGG - Intergenic
1142202713 16:88768732-88768754 TGGCTGAGGCTGCAGGGGTGGGG - Intronic
1142598822 17:1043029-1043051 AGGCTAAGGGTGCAGGAGTGGGG + Intronic
1143101018 17:4504780-4504802 TGGCGAAGGCTGGCAGAGCCAGG - Intronic
1143150888 17:4807209-4807231 TGGCTCCGTCTGCCAGGGTGAGG + Exonic
1144159512 17:12543828-12543850 TGGGGAAGGCTGCCATAGAGAGG + Intergenic
1144836573 17:18159506-18159528 TGGCCAAGGCTCCCAGGGAGGGG + Intronic
1146321473 17:31850133-31850155 TGGCCAAGGCTGTCGGAGGGAGG - Intergenic
1146435785 17:32845975-32845997 TGGCTAGGGTAGCCAGAGAGTGG + Intronic
1146785265 17:35714594-35714616 TGCCTCAGGCTCCCAAAGTGTGG - Intronic
1147578829 17:41617447-41617469 GGGCTCAGGATGCCAGAATGGGG - Intergenic
1147970746 17:44218386-44218408 TGGCTGAGTCTCTCAGAGTGTGG - Intronic
1148104353 17:45111519-45111541 TGGCTAAGACAGCCAGGGGGTGG - Exonic
1148771218 17:50068022-50068044 TGACTAAGGCTGCCTGTGTTTGG + Intronic
1150677895 17:67260662-67260684 TGGTTTAGGCTGAGAGAGTGGGG - Intergenic
1151288295 17:73129453-73129475 TGTCAGGGGCTGCCAGAGTGGGG + Intergenic
1151663820 17:75534191-75534213 GGGCTAAGGCCCCCAGAATGGGG + Intronic
1151725127 17:75878966-75878988 TTGCTAAGGGTGCCAGGGAGGGG - Intergenic
1151917637 17:77130201-77130223 TGTCTAAAGGTGCCAGTGTGGGG + Intronic
1152868341 17:82737124-82737146 TGGCCAGGGCTGCCAGGCTGGGG + Intronic
1153708770 18:7775590-7775612 TAGCTGAGGCTGTGAGAGTGGGG + Intronic
1157195567 18:45617707-45617729 TTGGTCAGGCTGCCAGAATGGGG - Intronic
1157410984 18:47463295-47463317 TGGTAAAGGCTGCCTGGGTGAGG - Intergenic
1157509873 18:48263230-48263252 GGGCTGAGGCAGTCAGAGTGTGG - Intronic
1158498252 18:57976093-57976115 TGGCTGTGGCTGTTAGAGTGAGG - Intergenic
1159399129 18:67907235-67907257 TGTTTAAGCCTGCCAGGGTGTGG + Intergenic
1160841291 19:1148020-1148042 TGGCCAAGGGGGCCGGAGTGGGG - Intronic
1161054940 19:2186108-2186130 TGGCAAAGGCTGTCAGAGGCCGG + Intronic
1161250290 19:3276390-3276412 TGGGTGAGGCTGCAAGGGTGGGG + Intronic
1162793118 19:13073167-13073189 TGGCCAGGGCAGCCAGGGTGGGG - Intronic
1166830544 19:45637031-45637053 TGGCTGAGACTGCAAAAGTGAGG - Intronic
1167793167 19:51692905-51692927 GGGCTAAGGGTCCCTGAGTGGGG - Intergenic
926088121 2:10032800-10032822 TGTCTAAGGCTGCCTGGGTTAGG - Intergenic
927138849 2:20116013-20116035 GGGCTGAGGCTGTCAGGGTGGGG + Intergenic
928903222 2:36343990-36344012 TGACTAAGGATGCCAGAATTTGG + Intergenic
929014990 2:37485101-37485123 TGCCAGTGGCTGCCAGAGTGAGG - Intergenic
931652687 2:64482785-64482807 AGGCTAAGCCTGCCAGGGAGGGG - Intergenic
934974636 2:98792163-98792185 TGCCTCAGCCTCCCAGAGTGTGG - Intergenic
936694352 2:114928859-114928881 TGGCTTAGGCTGCCACTCTGGGG - Intronic
938376085 2:130807765-130807787 TGGCTAGGCCTGCCTGGGTGAGG - Intergenic
940213321 2:151278280-151278302 TTGCTAAGTCTGCCATGGTGAGG - Intronic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
944733737 2:202541311-202541333 TAGCTAAGACTACAAGAGTGTGG - Intronic
946594654 2:221293426-221293448 TGCCTCAGCCTCCCAGAGTGCGG + Intergenic
946760120 2:222985170-222985192 AGGCTAAAGCTGCCACAGGGAGG + Intergenic
947534798 2:230933781-230933803 GGGCAAAGGCTGCCTGGGTGGGG + Intronic
948179561 2:235968917-235968939 TCGCCCAGGCTGCCAGGGTGGGG - Intronic
948897410 2:240933899-240933921 TGGCTGATGGTGGCAGAGTGGGG - Intronic
1169058179 20:2641142-2641164 TGGCTTTGGCTGGCAGAGGGAGG - Exonic
1172165257 20:32894902-32894924 TGCCCAAGACTGCCAGAGTGGGG - Intronic
1173811568 20:45959164-45959186 TGGGTCAGGATGACAGAGTGAGG - Intronic
1174157948 20:48528739-48528761 AGGCTGTGGCTGACAGAGTGAGG + Intergenic
1178961304 21:37068681-37068703 TGGCCAAGTCTCTCAGAGTGAGG - Intronic
1178991963 21:37364472-37364494 TGTCTAAGGCTGTCACACTGGGG + Intergenic
1179413369 21:41179100-41179122 TGACTGAGGGTGCCAGGGTGAGG + Intronic
1179914251 21:44466379-44466401 TGGCCAAGGTTGCTAGAGAGGGG + Intergenic
1180169465 21:46050396-46050418 TGCCAAGGGCTGCCAGGGTGCGG - Intergenic
1180177265 21:46096946-46096968 TGCCTAAGTGTGCCTGAGTGTGG - Intergenic
1180957107 22:19746043-19746065 TGGCCCAGGCTGGCAGACTGGGG - Intergenic
1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG + Intronic
1181177605 22:21046507-21046529 TAGCTAATCCTGCCAGAGTCAGG - Intronic
1181741355 22:24924281-24924303 TGGCTGAGGCTGCCGGGGTGAGG - Exonic
1183330126 22:37214968-37214990 TGGAGAAGGCTGCCAGAGCAGGG - Intergenic
1183698675 22:39437672-39437694 GGGCTGAGGCTGGCAGGGTGGGG + Intergenic
949865416 3:8543068-8543090 TGGCTCACTCTGCCAGAGTGGGG - Intronic
949877546 3:8635975-8635997 GTCCTAAGGATGCCAGAGTGAGG - Intronic
950980839 3:17302898-17302920 TTGCTAGGGCTTCCAAAGTGGGG - Intronic
952375690 3:32765402-32765424 TGTCTCAGCCTCCCAGAGTGTGG - Intronic
952875790 3:37943274-37943296 TGGCGAAGGCTTCCTGGGTGAGG + Intronic
953222870 3:40989358-40989380 TGGCTGAGGCTGCAAGGGTGAGG + Intergenic
956090363 3:65659889-65659911 TGGCAAAGGTTTCCAGAGTTTGG + Intronic
956705410 3:71995044-71995066 TGGCCCAGGTTCCCAGAGTGGGG + Intergenic
961633412 3:128317928-128317950 TGGCAAGGGCTGCCCCAGTGTGG - Intronic
961804487 3:129479544-129479566 TGGCCTAGGCTGCCTGGGTGGGG + Intronic
963146270 3:141998355-141998377 TGCCTTAGGCTCCCAAAGTGCGG - Intronic
964527347 3:157629736-157629758 TGCCTGATGCTGCCAGGGTGTGG + Intronic
966736704 3:183192527-183192549 TGACTAAGGCTGGCGGGGTGGGG + Intronic
967726611 3:192868220-192868242 TGGATATGACTGCCATAGTGAGG - Intronic
968093529 3:195912107-195912129 TGGGCCAGGCTGCCAGAGGGAGG + Intergenic
968142218 3:196267464-196267486 TGCCTCAGCCTGCCACAGTGTGG - Intronic
968472168 4:787156-787178 TGGCCAAGGCTGCCTGGATGCGG + Intronic
968957252 4:3725728-3725750 TGGCTCAGGCCGCCAGGGTCAGG + Intergenic
971400588 4:26272031-26272053 TGGTTAAGGCTGCCCTAGTCAGG - Intronic
972578777 4:40376462-40376484 TGTTTAAGCCTGCCAGCGTGTGG + Intergenic
972829705 4:42801173-42801195 TGGCTAAGATTGGCTGAGTGTGG - Intergenic
972954583 4:44373390-44373412 TGACTAAGGGCTCCAGAGTGGGG + Intronic
973162046 4:47031266-47031288 TGGCTAAGGCTGCCTGTGATTGG - Intronic
974920611 4:68234325-68234347 TTGCTAGGGGTGCCAGAGTTAGG + Intronic
976855353 4:89598101-89598123 AGGCTAATGCAGCCAGAATGAGG + Intergenic
978184005 4:105836258-105836280 TGCCTAAGTCTGGCAGAGTCCGG + Intronic
978359759 4:107918059-107918081 TGGGAAAGGCAGGCAGAGTGGGG - Intergenic
980877021 4:138671867-138671889 TGCCTAAGGCTGCTACTGTGGGG - Intergenic
980966374 4:139525063-139525085 TGGCTCAGCCTCCCAAAGTGCGG + Intronic
981844031 4:149145954-149145976 TGGCTAATGCTGAATGAGTGGGG + Intergenic
983682691 4:170371869-170371891 AAGCTAAGGCTGGCAGGGTGGGG - Intergenic
985550812 5:532701-532723 TGGCTCAGGCTGCCGGACTGGGG + Intergenic
986446489 5:7825759-7825781 GGGCTTGGGCTGCCTGAGTGTGG - Intronic
987179255 5:15349424-15349446 TGCCTATAGCAGCCAGAGTGGGG + Intergenic
987366860 5:17156580-17156602 TGCCTAAGCCTCCCAAAGTGCGG + Intronic
988499892 5:31775918-31775940 TGACTAAGGCTTCATGAGTGTGG + Intronic
991929091 5:71733977-71733999 TGCCTAAGGCTGGGGGAGTGGGG - Intergenic
997226385 5:132212461-132212483 TGGCTTAGGCAGCCAGAGGATGG + Intronic
998151983 5:139762847-139762869 AGGCAAAGGTTGGCAGAGTGGGG + Intergenic
1001314784 5:170634179-170634201 TGGAGAAGGCTGGTAGAGTGAGG + Intronic
1003132641 6:3408611-3408633 TGGCTGAAGCTGCCAGAGAATGG - Intronic
1003270141 6:4601219-4601241 TGGAGAAGGCAGCCAAAGTGTGG - Intergenic
1003809787 6:9767196-9767218 TTCCTGATGCTGCCAGAGTGTGG - Intronic
1004715795 6:18215320-18215342 TGTCTAAGGCAGCCAGTCTGCGG - Intronic
1004915969 6:20332386-20332408 TAGCCAAGGCTGGGAGAGTGAGG + Intergenic
1005824387 6:29623902-29623924 TGGCTGAGGCTGCTAGGATGTGG - Exonic
1006922117 6:37633952-37633974 TGGCTCAGGCTGTCAGAGTGAGG - Exonic
1010213638 6:73382800-73382822 TGGCTCAGCCTCCCAAAGTGTGG + Intronic
1010348826 6:74847008-74847030 TGGCTAAGGCTGCTTATGTGAGG - Intergenic
1013453529 6:110308931-110308953 TGCCTAAGGATGGCAGACTGGGG + Intronic
1015701761 6:136043383-136043405 AGGCTAAGGGTGCCAGAGTGTGG + Intronic
1018798892 6:167207638-167207660 TGGCTGAGGGTGCCAGGGGGAGG + Intergenic
1019997428 7:4733864-4733886 TGGCTATGACGGCCAGAGAGAGG - Intronic
1020070832 7:5226019-5226041 TGGCTAACGATGTCAGAGGGTGG - Intronic
1020676278 7:11188713-11188735 TGCTAAAGGCTGCCTGAGTGTGG + Intergenic
1021072727 7:16262237-16262259 TGACTAAGGCAGCCAATGTGTGG - Intronic
1021454135 7:20811059-20811081 TGCCTCAGGCTCCCAAAGTGCGG + Intergenic
1024558387 7:50623127-50623149 CAGCTGAGGCTGCCAGAATGGGG - Intronic
1024685262 7:51737768-51737790 GGGCAAAGGCAGCCAGAATGAGG - Intergenic
1025110963 7:56215751-56215773 TGGTTAAGGCTACCACAGTGGGG + Intergenic
1027423406 7:78039312-78039334 TGCCTAAAGGTGCCAGTGTGGGG + Intronic
1027566480 7:79801097-79801119 TGGCAAAGGCTGAAAGAGTTTGG - Intergenic
1028086537 7:86644179-86644201 TGCCTAAGGATTTCAGAGTGAGG + Exonic
1028585195 7:92445636-92445658 GGGCTAAGGCTGGCAAATTGTGG + Intergenic
1029132188 7:98339976-98339998 TGGCTGTGGCTGACAGCGTGAGG + Intronic
1031382118 7:121099692-121099714 TGATTAAATCTGCCAGAGTGGGG + Intronic
1032297101 7:130649283-130649305 TGGCTAAGGGTGCTAAAGTCAGG - Intronic
1032303224 7:130709122-130709144 TTGCTGAGACTGCCACAGTGGGG - Intergenic
1035708631 8:1695948-1695970 TGGCCAAGGCTGCCCTCGTGTGG + Intronic
1035948503 8:3992533-3992555 TGGCTCAGCCTCCCAAAGTGTGG - Intronic
1039109731 8:34028649-34028671 CCGCCCAGGCTGCCAGAGTGGGG - Intergenic
1039677038 8:39679731-39679753 TGACTAATTCTCCCAGAGTGCGG + Intronic
1040392033 8:46958466-46958488 TGGCTGCAGCTGCCCGAGTGTGG - Intergenic
1040984910 8:53283166-53283188 AGGCTAAGGCAGCCCGAATGTGG + Intergenic
1044872204 8:96630451-96630473 TGAGAAAGGCTGCTAGAGTGTGG - Intergenic
1045210200 8:100089558-100089580 TGGCTAAGACTCCCTGAGTCTGG + Intronic
1046491058 8:114953317-114953339 TGGCAAAGGCTGGTAGAGAGTGG - Intergenic
1048292481 8:133191384-133191406 TGGCTGAAGCTGGCAGGGTGAGG + Intronic
1049283068 8:141760393-141760415 AGGCTGAGGCTGCCACAGGGTGG + Intergenic
1049853949 8:144850000-144850022 GGGCTCAGGCGGCCAGTGTGGGG - Intronic
1058195167 9:101965522-101965544 AGGCTGAGGCTGCCAGGTTGTGG + Intergenic
1060271523 9:122145899-122145921 TGCCTCAGCCTCCCAGAGTGCGG - Intronic
1060796800 9:126517338-126517360 TGGCTGAGGCTGCCGCACTGGGG + Intergenic
1061374502 9:130215964-130215986 TGGCTGCTGCTGCCGGAGTGAGG - Intronic
1186606530 X:11098475-11098497 TGGATATGGCTGCCAGCCTGTGG + Intergenic
1190730949 X:53225126-53225148 TGGCGAAGGCTGCGGTAGTGGGG - Exonic
1192163606 X:68808541-68808563 TGGCGAAGGAAGCCTGAGTGAGG - Intergenic
1192491550 X:71580059-71580081 TGGGTAAGATTGACAGAGTGGGG + Intronic
1193593886 X:83422405-83422427 TGGCTAAAGTTGGAAGAGTGTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1193965056 X:87975043-87975065 TGGCAGAGGCTGGAAGAGTGTGG + Intergenic
1194392085 X:93331616-93331638 TGGGTAAGTCTGCCTGATTGTGG - Intergenic
1197271279 X:124427175-124427197 TGGCCTCGGCTCCCAGAGTGGGG - Intronic
1198619445 X:138490170-138490192 TTGCAATGCCTGCCAGAGTGTGG + Intergenic
1199281017 X:145999293-145999315 TGGCTAATGCTGACAGTTTGTGG - Intergenic