ID: 912687639

View in Genome Browser
Species Human (GRCh38)
Location 1:111779667-111779689
Sequence CTGGACTCCCTGAGAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912687636_912687639 12 Left 912687636 1:111779632-111779654 CCATGGCTCTGTTTTAACAATCA 0: 1
1: 0
2: 0
3: 36
4: 278
Right 912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG 0: 1
1: 0
2: 1
3: 22
4: 186
912687635_912687639 18 Left 912687635 1:111779626-111779648 CCTAAACCATGGCTCTGTTTTAA 0: 1
1: 0
2: 1
3: 28
4: 226
Right 912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG 0: 1
1: 0
2: 1
3: 22
4: 186
912687634_912687639 19 Left 912687634 1:111779625-111779647 CCCTAAACCATGGCTCTGTTTTA 0: 1
1: 0
2: 1
3: 13
4: 183
Right 912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG 0: 1
1: 0
2: 1
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912687639 Original CRISPR CTGGACTCCCTGAGAACCAC AGG Intronic
900308638 1:2023018-2023040 CTGGGCCCCCTGAGGACCACCGG - Intronic
900694623 1:4002121-4002143 ATGAACACCCTGAGAAGCACGGG + Intergenic
902094418 1:13930872-13930894 CAGGACCCCCTAAGGACCACTGG - Intergenic
902406990 1:16189833-16189855 CTGGACACCAGGAGACCCACTGG - Intergenic
902512114 1:16972229-16972251 CTGGTCTCACTGAGAGCCAGGGG - Intronic
904038228 1:27570089-27570111 CTGGGCTTCCTGAGACCCGCTGG - Intronic
904629273 1:31829267-31829289 CTGGCCTCCCTGAGACTCACGGG - Intergenic
905916503 1:41688294-41688316 CAGGACACCCTGAGAAAGACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909054926 1:70809398-70809420 GTGGACTCCCTCAGAACCTGTGG + Intergenic
912437559 1:109672495-109672517 CTGGGCTCCCTGCGAGCCTCTGG + Intronic
912440044 1:109690845-109690867 CTGGGCTCCCTGTGAGCCTCTGG + Intronic
912443402 1:109715521-109715543 CTGGGCTCCCTGTGAGCCTCTGG + Intronic
912487984 1:110044011-110044033 CCGGCCTCCCTGAGACCCTCAGG - Intronic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
914000752 1:143692348-143692370 CTGAACTCCCGCAGGACCACGGG + Intergenic
915699813 1:157781181-157781203 CTGGGTTCCATGAGAACAACAGG + Intergenic
917854623 1:179090353-179090375 CTGGACTACCTGAGAACTTGAGG - Intronic
918951255 1:191142562-191142584 CTGGCCTCCCAGAGTAACACTGG + Intergenic
1062955702 10:1538942-1538964 CTGCACCCTCTGAGACCCACAGG - Intronic
1063814644 10:9758378-9758400 CTGGACTCACTGACAGCCATAGG - Intergenic
1065089764 10:22220056-22220078 CTGGGCTCCCTGATAACAATGGG + Intergenic
1066101711 10:32123401-32123423 TTGGACTCCATGAGACACACAGG + Intergenic
1067911103 10:50347742-50347764 GGAAACTCCCTGAGAACCACAGG + Intronic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070449541 10:76544047-76544069 TTAGACTCCCTGAGCACCAGTGG - Intronic
1073100083 10:101001910-101001932 GTGGACTCCCTAAGAGCCGCGGG + Exonic
1074293599 10:112160775-112160797 CTGAATTTCCTGAGAACCCCAGG + Exonic
1074467049 10:113692522-113692544 CTGGTCTGCCTGAGAAACAAAGG + Intronic
1075918249 10:126188293-126188315 CTAGACTCCATGTGTACCACTGG + Intronic
1076265834 10:129109349-129109371 CAGGGCTCCCAGAGAACCAGGGG + Intergenic
1077253150 11:1569538-1569560 CAGGATCCCCTGAGAACCCCAGG + Intronic
1079085261 11:17440501-17440523 TTGGAGGCTCTGAGAACCACAGG + Intronic
1080693666 11:34581982-34582004 ATAGAATCCCTGAGAATCACAGG - Intergenic
1082667990 11:55998132-55998154 CTCTAGTCCCTGACAACCACTGG + Intergenic
1082668058 11:55999304-55999326 CTCTAGTCCCTGACAACCACTGG - Intergenic
1086915792 11:92528686-92528708 CTGGACTCCCTCAAAAGAACTGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089896562 11:121935850-121935872 CTGCTCTCCCTGAGACCCATAGG - Intergenic
1090394409 11:126409182-126409204 CTCGCCTCGCTGAGGACCACTGG + Intronic
1090404702 11:126469650-126469672 TTGGTCTCCATGAGAACCACTGG + Intronic
1090846159 11:130531835-130531857 CTGGAGCCCCTGAGAAGCAGAGG + Intergenic
1091092625 11:132786862-132786884 CTGTACACCCTGAGGACCACAGG - Intronic
1091643339 12:2254228-2254250 CCCCACTCCCTGAGAACAACTGG - Intronic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1096687840 12:53300453-53300475 AGGGACTCCCTGGGAACCAAAGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098961607 12:76745007-76745029 CTGGACTCCCTAATATCAACTGG + Intergenic
1103340060 12:120216396-120216418 CTGGACCCCAGAAGAACCACAGG + Intronic
1103471365 12:121184468-121184490 CTCAACTCCCTGAGAGCCACAGG + Exonic
1103702912 12:122856886-122856908 CAGGGCTCCCTGAGGACCAGCGG - Intronic
1103913173 12:124363065-124363087 CTGGCTTCCCTGAGACCCAGAGG - Intronic
1106251007 13:27981390-27981412 CTAGATTCCCTGAGAACCACGGG - Intronic
1108698800 13:52926307-52926329 CTAGCTTCTCTGAGAACCACAGG + Intergenic
1114402960 14:22426670-22426692 TTGGACTCCCTTAGATCCTCGGG + Intergenic
1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG + Intronic
1114610300 14:24036003-24036025 GTGGACTCCATGGGGACCACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118411923 14:65488403-65488425 CTGAGCTCCCTGAAAAGCACAGG - Intronic
1119776439 14:77251973-77251995 CTGGGCTCCCATAGCACCACAGG + Intronic
1120953574 14:90062553-90062575 CCGGACTCGCTGACAACCTCCGG + Intronic
1121797327 14:96745957-96745979 CTGGAAGCCCTGGGAGCCACAGG - Intergenic
1123162655 14:106294095-106294117 CTGCCCTCCCTGAAATCCACAGG - Intergenic
1124900982 15:33822250-33822272 CCGGAGTGCCTGAGAAACACCGG - Intronic
1125512896 15:40302401-40302423 CTGGACTTCCTGAGAGACACAGG - Intronic
1126434491 15:48622324-48622346 CTGGCCTCCCTGAGTTCCCCAGG - Intronic
1129890413 15:79068096-79068118 CTGGGCTCCCTCAGGAACACAGG - Intronic
1130525574 15:84703231-84703253 CTGAACTCCCTGACATGCACCGG + Intronic
1131915265 15:97258175-97258197 CTGGACACCATGAGGACTACTGG - Intergenic
1133931915 16:10239650-10239672 CTGGACGACCTGAGAACCAGAGG + Intergenic
1136373157 16:29848601-29848623 CTGGGCTCCTGGAGAACCAGTGG - Intergenic
1140124442 16:72107972-72107994 AAGCATTCCCTGAGAACCACTGG - Intronic
1142011025 16:87714260-87714282 ATGGACTGACTGAGAAGCACGGG - Intronic
1142286037 16:89171950-89171972 CAGGTCTCCCCCAGAACCACTGG + Intronic
1142908307 17:3063544-3063566 CAGGACTCTCTGAGATCCCCAGG + Exonic
1142926260 17:3240717-3240739 CAGGACTCTCTGAGATCCCCAGG - Intergenic
1142928856 17:3265652-3265674 CAGGACTCTCTGAGATCCCCAGG - Intergenic
1143525410 17:7469048-7469070 CTCGCCTCCATGAGAACCACTGG + Intronic
1145242811 17:21249547-21249569 CTGGCCTCCCTCAGCACCCCTGG - Intronic
1146352370 17:32105388-32105410 TGGGTCTCCCTGAGACCCACTGG + Intergenic
1147187902 17:38722567-38722589 CTAGACTCCCTCAGACCCAGGGG - Intronic
1147552504 17:41454062-41454084 CTGGACTGACTGTGAGCCACAGG + Intergenic
1148099847 17:45082513-45082535 TTCTACTCCATGAGAACCACTGG + Intronic
1148957492 17:51365800-51365822 CTGAACTCGCTGAGACACACAGG + Intergenic
1148986711 17:51628806-51628828 CTGGACTTCCTGAGCACCCATGG - Intergenic
1150024774 17:61662405-61662427 CTGGAGGCACTGAGAACCCCAGG + Intergenic
1150075213 17:62186303-62186325 CTGGGCTCCCTGAGAGTAACGGG - Intergenic
1152464137 17:80456336-80456358 CTGCACTCCCTGGGGACCTCTGG + Intergenic
1153482832 18:5564771-5564793 CTGGACTCCCTGCCACCAACAGG + Intronic
1153661982 18:7333428-7333450 CTGGACTCCCTCAGACTCAAGGG - Intergenic
1155839277 18:30627229-30627251 TTGGACTCCCTAAGTACCTCCGG - Intergenic
1157452789 18:47800881-47800903 CTGGACTTGCTGAGAGCCCCAGG + Intergenic
1158772217 18:60532828-60532850 ATGGACTCTCTGATAACCACTGG + Intergenic
1159866129 18:73707497-73707519 CTCTAACCCCTGAGAACCACTGG - Intergenic
1159939747 18:74397763-74397785 CAGGGCACTCTGAGAACCACTGG + Intergenic
1160748807 19:724040-724062 CTGAACTCCGTGTGAACCACGGG + Intronic
1160974983 19:1788795-1788817 CTGGACGCACTGAGAACCCTGGG - Intronic
1161033894 19:2073279-2073301 CTGGTCTCCCTGAGATGCTCAGG + Exonic
1162398187 19:10430171-10430193 CTGGGCTCTCAGAGCACCACTGG + Intronic
1163551685 19:17969099-17969121 CTGGAGTCCCTGGGACCCTCAGG - Intronic
1165112969 19:33512945-33512967 CTGATCCCCCTGAGGACCACAGG + Intronic
1167412848 19:49355303-49355325 CTGGACCACCTGAGGACCAGTGG + Exonic
1168289024 19:55347955-55347977 CCGGCCTCCCTGAGACCCACGGG - Exonic
936573204 2:113633454-113633476 GTGGATCCACTGAGAACCACAGG + Intronic
936763043 2:115809602-115809624 CTAGAATCCTTGAGAACCAAGGG - Intronic
937219935 2:120336943-120336965 CTGGACTCCCTGCCACCCCCTGG + Intergenic
939271127 2:139940901-139940923 CTGTTCTGCCTCAGAACCACAGG + Intergenic
944946395 2:204691415-204691437 TTGGAAGCCCTGAAAACCACTGG - Intronic
945892172 2:215441801-215441823 ATGGTCTCCCTCAGAACCAAAGG + Intergenic
947317210 2:228873663-228873685 CTTGACTCCCTTAGCTCCACTGG - Intronic
948178664 2:235962963-235962985 CTGGATTCCCACAGATCCACCGG - Intronic
1169227778 20:3866746-3866768 CTGGCTTCCCTGAGGTCCACAGG - Exonic
1170333074 20:15236938-15236960 CTACACCCACTGAGAACCACTGG - Intronic
1170544805 20:17426631-17426653 CTGGAGACCCTGAGAGCCAATGG + Intronic
1171282751 20:23914746-23914768 CAGGAGTGGCTGAGAACCACAGG - Intergenic
1171287592 20:23954478-23954500 CAGGAGTGGCTGAGAACCACAGG - Intergenic
1172766825 20:37355516-37355538 CTGGACTCTCTGTTATCCACCGG + Intronic
1172970936 20:38872646-38872668 CAGGGATCACTGAGAACCACTGG + Intronic
1173149017 20:40550138-40550160 CTGATGCCCCTGAGAACCACTGG + Intergenic
1175737898 20:61399895-61399917 CAGGAGTGCGTGAGAACCACTGG - Intronic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1179094430 21:38299625-38299647 CTGGAATCCCAGACAACCATTGG + Exonic
1179620732 21:42614024-42614046 ATGGACACCCCCAGAACCACTGG - Intergenic
1181330471 22:22086940-22086962 TTGGCCTCCCTGGGCACCACTGG + Intergenic
1184656214 22:45943470-45943492 CTGGGCTCCCCGAGCACCTCAGG - Intronic
1185149458 22:49155687-49155709 CTGGACTGCCTGAGAACGTCTGG - Intergenic
1185426981 22:50777426-50777448 GTGGATCCACTGAGAACCACAGG - Intronic
949497407 3:4645654-4645676 CACGTCTTCCTGAGAACCACGGG + Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950252026 3:11473943-11473965 GTGAACTCCCTGATAAGCACAGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
953131419 3:40143009-40143031 CTGGACTGCCTGTGTCCCACAGG - Intronic
959381657 3:105648351-105648373 CTGGACACACAGAGAAACACAGG + Intergenic
960138189 3:114126452-114126474 CTGGACTGCCAGAGGACCTCAGG - Intergenic
961539228 3:127589224-127589246 CAGGACCCGCTGAGAACGACTGG + Intronic
961540064 3:127593321-127593343 CTGGGCTCCCTGATAGCCATGGG + Intronic
961784815 3:129341394-129341416 CTGGATACACTGAGCACCACTGG + Intergenic
965371111 3:167863609-167863631 CTGGTCTCCCTGCGATCCACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967173723 3:186844125-186844147 CCGGGCTCCCTGTGTACCACTGG - Intronic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
968081726 3:195850993-195851015 CTGTCCTCGCTGAGAACGACTGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969456733 4:7304526-7304548 CTGGGCTCCCTGATATCCTCTGG + Intronic
969974037 4:11079460-11079482 CTGGTCATCCTGAGAACTACAGG + Intergenic
972618041 4:40719112-40719134 CTGGACTCCCTGTGTAACACAGG - Intergenic
974169650 4:58250210-58250232 CTGGACTCCTTGAGAGACAGGGG - Intergenic
975746793 4:77482720-77482742 TTGGATTCCCTGAGAACCCAAGG - Intergenic
976821847 4:89215656-89215678 CTGGACTGCCTGAGGCCCATGGG - Intergenic
984334915 4:178378851-178378873 GTGGCCCACCTGAGAACCACAGG + Intergenic
986733756 5:10653399-10653421 CTGCACTCCCTGAGCCTCACTGG - Intergenic
990122955 5:52478256-52478278 CTGGAGATTCTGAGAACCACTGG + Intergenic
995625173 5:114068645-114068667 CTGGACCCTCTGGGAAGCACTGG - Intergenic
997279322 5:132629117-132629139 CTGCATACCCTGAGAACCAGTGG + Intronic
997403240 5:133619087-133619109 CTGGGCTCCCTGATCACCACTGG - Intergenic
999783335 5:154868988-154869010 CTGGATCCCCTGAGACTCACTGG + Intronic
1001076222 5:168630038-168630060 AAGGGCTCCCTGAGAACTACTGG + Intergenic
1001441272 5:171744808-171744830 ATGGGCTCCTTGAGAAGCACTGG + Intergenic
1001528331 5:172444907-172444929 CTGGCTGACCTGAGAACCACAGG - Intronic
1002409181 5:179060627-179060649 CTGGACTGCCGGAGACCCGCGGG + Exonic
1002576977 5:180179412-180179434 CTCCACTCCCTGTGCACCACTGG - Intronic
1005837938 6:29722064-29722086 CTGGACTCCCACAGAAACTCAGG + Intergenic
1006201586 6:32297523-32297545 GTGCTCTCCCTGACAACCACTGG - Intronic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1010713290 6:79200418-79200440 CAGGAGTCCCTGAGCAGCACAGG + Intergenic
1011739143 6:90342101-90342123 CAGGAATCCCTGTGAACCCCAGG - Intergenic
1014804675 6:125815623-125815645 CTGGATTCGCTGAGCAACACTGG - Intronic
1015100718 6:129476490-129476512 CTGGACTCAATGGTAACCACGGG - Intronic
1015514866 6:134073666-134073688 CTGGTCTCCATTGGAACCACTGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018115251 6:160577575-160577597 CTGGTTTTCATGAGAACCACAGG + Intronic
1018215600 6:161524186-161524208 GTGGACTCCCTGAGCAGCAAGGG + Intronic
1018745015 6:166755061-166755083 CTGGGCTCCTTGACAAGCACAGG - Intronic
1023561270 7:41475599-41475621 AGGAGCTCCCTGAGAACCACAGG - Intergenic
1023856887 7:44189481-44189503 CTGGTCACCATGACAACCACAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028819559 7:95190527-95190549 GTGGACACACTGAGAACCACTGG + Intronic
1028986543 7:97013458-97013480 CGGGGCTCCTTTAGAACCACAGG - Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031988442 7:128178965-128178987 CACCACTGCCTGAGAACCACTGG - Intergenic
1033357003 7:140608017-140608039 CTGTACTTCCTGAGAACTATAGG - Intronic
1036079717 8:5541999-5542021 CTTGACTCCCCGAGCACCCCTGG - Intergenic
1036132157 8:6125717-6125739 CTGGAGCCCCGGAGAACGACGGG + Intergenic
1038220339 8:25601298-25601320 GTCGACTCACTGAGAAACACTGG - Intergenic
1039441345 8:37597561-37597583 CTGGACTTCCTGGGAATCCCAGG + Intergenic
1041225480 8:55693226-55693248 CTGTACACCCTGAAAAGCACAGG + Intergenic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1041844421 8:62311574-62311596 CTGGACTCCATGAGCCCCTCTGG + Intronic
1048314626 8:133352882-133352904 ATGGACTCCCTGGGAGGCACGGG - Intergenic
1049339460 8:142104352-142104374 CTGGCCTCTCTGAGAAGCACCGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053114476 9:35489621-35489643 CTGGACCGACTCAGAACCACTGG - Intergenic
1054948804 9:70825672-70825694 CTGGCCTCCCTGAGGAGCAGAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058453646 9:105119473-105119495 CTGGAGAGCCTGAGAACCACAGG - Intergenic
1059394884 9:114028082-114028104 CTGGAGTCACTGAGAACCGGGGG - Intronic
1060804724 9:126567704-126567726 CTGGAAGACCTGAGAACCAAAGG + Intergenic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1061484012 9:130911349-130911371 CTGGACACACTCAGCACCACTGG + Intronic
1061609177 9:131735009-131735031 CTGTGCTCCCAGCGAACCACAGG - Intronic
1061764267 9:132871543-132871565 CTCGACTCCCTGAGAGCATCCGG + Intronic
1187172066 X:16861763-16861785 CTGGAGTCTCTGAGGAACACTGG + Intronic
1187877639 X:23817258-23817280 ATGGCCTGACTGAGAACCACTGG + Intergenic
1194403616 X:93467819-93467841 CTTGGATCCCTGAGAACCCCTGG + Intergenic
1195751235 X:108163296-108163318 CTGGACTGCCTGTCACCCACTGG - Intronic
1198115715 X:133542998-133543020 CTAGACTCCCAGAGACCCAAGGG - Intronic
1199937406 X:152588400-152588422 CAGGAATTCCTGACAACCACTGG + Intergenic
1200277735 X:154750717-154750739 CTGGAGTCCCTGAGCCCCGCGGG + Intronic