ID: 912689821

View in Genome Browser
Species Human (GRCh38)
Location 1:111796380-111796402
Sequence TGGTCTGGTCTACCATTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1351
Summary {0: 1, 1: 0, 2: 9, 3: 118, 4: 1223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912689821_912689822 -9 Left 912689821 1:111796380-111796402 CCTATCAATGGTAGACCAGACCA 0: 1
1: 0
2: 9
3: 118
4: 1223
Right 912689822 1:111796394-111796416 ACCAGACCAAAAAAAAAATGTGG No data
912689821_912689825 7 Left 912689821 1:111796380-111796402 CCTATCAATGGTAGACCAGACCA 0: 1
1: 0
2: 9
3: 118
4: 1223
Right 912689825 1:111796410-111796432 AATGTGGCACATATACATCATGG 0: 421
1: 21574
2: 12950
3: 9708
4: 7909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912689821 Original CRISPR TGGTCTGGTCTACCATTGAT AGG (reversed) Intronic
902139663 1:14342221-14342243 TTATCCAGTCTACCATTGATGGG + Intergenic
902930493 1:19727810-19727832 TTATCCAGTCTACCATTGATGGG - Intronic
903233704 1:21936838-21936860 TGGTCCGGCCTACCATTCCTGGG - Intronic
903347879 1:22699205-22699227 TTATCTAGTCTATCATTGATAGG - Intergenic
904734696 1:32622328-32622350 TTATCCAGTCTACCATTGATGGG - Intronic
906735788 1:48125801-48125823 TTATCTGGTCTACCACTGATGGG - Intergenic
906881352 1:49594751-49594773 TTATCTAGTCTATCATTGATGGG + Intronic
906882059 1:49602448-49602470 TTATCTAGTCTATCATTGATGGG - Intronic
906890731 1:49710196-49710218 TTATCCAGTCTACCATTGATGGG - Intronic
906971866 1:50523777-50523799 TTATCTAGTCTCCCATTGATGGG + Intronic
907062878 1:51449194-51449216 TAATCCAGTCTACCATTGATGGG - Intronic
907612929 1:55890596-55890618 TTATCTAGTCTACCACTGATGGG + Intergenic
907653873 1:56322528-56322550 TGTTCAGGTCTTCAATTGATTGG + Intergenic
907846849 1:58216414-58216436 TTATCTAGTCTATCATTGATGGG + Intronic
907927620 1:58969272-58969294 TTATCTAGTCTATCATTGATGGG - Intergenic
907979748 1:59469984-59470006 TTATCCAGTCTACCATTGATGGG + Intronic
908193992 1:61730810-61730832 TCATCTAGTCTATCATTGATGGG - Intergenic
908407173 1:63826478-63826500 TTATCTAGTCTATCATTGATGGG + Intronic
908434962 1:64096629-64096651 TTGTCCAGTCTATCATTGATGGG + Intronic
908668380 1:66518064-66518086 TTATCCAGTCTACCATTGATGGG - Intergenic
908938739 1:69407475-69407497 TTATCCAGTCTACCATTGATAGG + Intergenic
908950949 1:69562073-69562095 TTATCTAGTCTATCATTGATGGG - Intergenic
909416183 1:75408469-75408491 TTATCTAGTCTATCATTGATGGG - Intronic
909471598 1:76034967-76034989 TTATCTAGTCTATCATTGATGGG + Intergenic
909714862 1:78695374-78695396 TTATCCAGTCTACCATTGATGGG + Intergenic
910190949 1:84595082-84595104 TTATCTAGTCTATCATTGATGGG - Intergenic
910263362 1:85313009-85313031 TTATCTAGTCTATCATTGATGGG + Intergenic
910443279 1:87274908-87274930 TGGTCTGAGCTACCTTTGATGGG + Intergenic
910570797 1:88700136-88700158 TTATCTAGTCTGCCATTGATGGG + Intronic
910582303 1:88842150-88842172 TTGTCCAGTCTATCATTGATGGG - Intergenic
910642484 1:89479023-89479045 TGATCTAGTCTATCATTGATGGG - Intergenic
910731661 1:90404203-90404225 TTATCTAGTCTACCATAGATGGG + Intergenic
910813297 1:91260148-91260170 TTATCCAGTCTACCATTGATGGG - Intergenic
910941149 1:92535514-92535536 TGATCCAGTCTATCATTGATGGG - Intronic
910950384 1:92640835-92640857 TAATCTAGTCTATCATTGATGGG - Intronic
911468819 1:98290332-98290354 TTATCTAGTCCACCATTGATGGG + Intergenic
911521793 1:98938731-98938753 TTATCCAGTCTACCATTGATGGG - Intronic
911537022 1:99112544-99112566 TTATCCAGTCTACCATTGATGGG + Intergenic
911571562 1:99523591-99523613 TTATCCAGTCTACCATTGATGGG + Intergenic
912139652 1:106707712-106707734 TTATCTAATCTACCATTGATGGG + Intergenic
912151910 1:106869895-106869917 TTATCTAGTCTATCATTGATGGG + Intergenic
912234837 1:107838709-107838731 TTATCTGGTCTACCGTTGTTGGG - Intronic
912261676 1:108116912-108116934 TTATCTAGTCTATCATTGATGGG + Intergenic
912689821 1:111796380-111796402 TGGTCTGGTCTACCATTGATAGG - Intronic
912928622 1:113935413-113935435 TTCTTTAGTCTACCATTGATGGG + Intronic
913352020 1:117872446-117872468 TTATCTAGTCTATCATTGATGGG - Intronic
913713978 1:121515354-121515376 TTATCCAGTCTACCATTGATGGG - Intergenic
914217921 1:145650370-145650392 TTATCCGGTCTATCATTGATGGG + Intronic
914324895 1:146603023-146603045 TTATCCAGTCTACCATTGATGGG + Intergenic
914470475 1:147973045-147973067 TTATCCGGTCTATCATTGATGGG + Intronic
915023856 1:152807508-152807530 TTATCTAGTCTACCATTGATGGG + Intronic
915049607 1:153054481-153054503 TTATCTAGTCTATCATTGATGGG - Intergenic
915050638 1:153068486-153068508 TTATCTAGTCTATCATTGATGGG - Intergenic
915649677 1:157300573-157300595 TTATCCAGTCTACCATTGATAGG - Intergenic
915695335 1:157735631-157735653 TTATCCGGTCTACTATTGATGGG + Intergenic
915757977 1:158281370-158281392 TGATCCAGTCTATCATTGATGGG + Intergenic
915991184 1:160518527-160518549 TTATCCGGTCTATCATTGATGGG - Intronic
916372560 1:164115831-164115853 TTATCTAGTCTACCATTGATGGG + Intergenic
916770923 1:167907181-167907203 TGGGCTGGAATACCATAGATGGG + Intronic
916864298 1:168838627-168838649 TTATCCGGTCTACCACTGATGGG - Intergenic
917253043 1:173083365-173083387 TTATCCAGTCTACCATTGATGGG - Intergenic
917253588 1:173089585-173089607 TTATCCAGTCTACCATTGATGGG + Intergenic
917290412 1:173466876-173466898 TTGTCCAGTCTATCATTGATGGG - Intergenic
917384641 1:174457749-174457771 TGCCCTGGTCTTCCAGTGATGGG + Intronic
917622701 1:176813176-176813198 TTATCTAGTCTACCGTTGATAGG + Intronic
917890791 1:179436446-179436468 TTATCCAGTCTACCATTGATGGG - Intronic
918359940 1:183747040-183747062 TTTTCCAGTCTACCATTGATGGG + Intronic
918928243 1:190815832-190815854 TTATCCAGTCTACCATTGATGGG - Intergenic
919015251 1:192025137-192025159 TTATCCAGTCTACCATTGATGGG + Intergenic
919136051 1:193509114-193509136 TTATCCGGTCTATCATTGATGGG + Intergenic
919190543 1:194211864-194211886 TAGTCTAGTCTACTGTTGATGGG - Intergenic
919243997 1:194953564-194953586 TTATCTAGTCTACCATTGGTGGG - Intergenic
919259624 1:195175172-195175194 TCATCCAGTCTACCATTGATGGG + Intergenic
919264219 1:195239717-195239739 TTATCCAGTCTACCATTGATGGG + Intergenic
919401642 1:197125918-197125940 TGGGTTGGTCTACAATTGACTGG - Intronic
919459121 1:197855878-197855900 TTATCCAGTCTACCATTGATGGG - Intergenic
920166137 1:204037344-204037366 TGTTCTGGGCTTCCAGTGATTGG - Intergenic
921104782 1:211965553-211965575 TTATCTGGTCTGCCATCGATGGG - Intronic
921298853 1:213730158-213730180 TTATCTAGTCTATCATTGATAGG + Intergenic
921351230 1:214237758-214237780 TTATCCAGTCTACCATTGATGGG - Intergenic
921728946 1:218555095-218555117 TTGTCCAGTCTATCATTGATGGG + Intergenic
921904467 1:220482181-220482203 TTATCTAGTCTAACATTGATGGG - Intergenic
921979963 1:221245804-221245826 TTATCCAGTCTACCATTGATGGG + Intergenic
922384369 1:225067351-225067373 TTATCTAGTCTATCATTGATGGG + Intronic
922395405 1:225195264-225195286 TTATCCAGTCTACCATTGATGGG - Intronic
922409726 1:225360232-225360254 TTATCTAGTCTATCATTGATGGG + Intronic
923287662 1:232512476-232512498 TTATCTAGTCTATCATTGATGGG - Intronic
923636210 1:235699463-235699485 TTATCTAGTCTATCATTGATGGG + Intronic
923820012 1:237428355-237428377 TTATCTGGTCTATCATTGATGGG - Intronic
923855898 1:237845242-237845264 TTATCCAGTCTACCATTGATAGG - Intergenic
924070716 1:240275476-240275498 TTATCTAGTCTATCATTGATGGG + Intronic
924918959 1:248605644-248605666 TTATCCAGTCTACCATTGATGGG + Intergenic
1063731250 10:8699446-8699468 TTATCTAGTCTATCATTGATGGG + Intergenic
1063751624 10:8955244-8955266 TTATCCAGTCTACCATTGATGGG - Intergenic
1064314140 10:14238918-14238940 TTATCTAGTCTATCATTGATGGG + Intronic
1064368499 10:14729794-14729816 TAATCCGGTCTATCATTGATGGG - Intronic
1064371603 10:14756767-14756789 TTATCTAGTCTATCATTGATGGG - Intronic
1064448738 10:15422122-15422144 TTATCCAGTCTACCATTGATGGG + Intergenic
1064497805 10:15932384-15932406 TTATCTAGTCTACCATTGATAGG + Intergenic
1064801637 10:19081370-19081392 TTATCCGGTCTATCATTGATGGG - Intronic
1064838322 10:19560568-19560590 TTATCTAGTCTATCATTGATGGG - Intronic
1064844048 10:19631379-19631401 TTGTCCAGTCTGCCATTGATTGG + Intronic
1064847947 10:19677050-19677072 TTTTCTAGTCTATCATTGATAGG + Intronic
1064892043 10:20186801-20186823 TTATCCAGTCTACCATTGATGGG + Intronic
1064935992 10:20679704-20679726 TAATCCAGTCTACCATTGATGGG - Intergenic
1065120088 10:22520913-22520935 TTCTCTAGTCTATCATTGATGGG + Intergenic
1065193491 10:23237270-23237292 TTGTCCAGTCTACCATTGATGGG + Intronic
1065653037 10:27914087-27914109 TTATCCAGTCTACCATTGATGGG - Intronic
1065937109 10:30530364-30530386 TTATCCAGTCTACCATTGATGGG + Intergenic
1065961963 10:30740899-30740921 TTATCCAGTCTACCATTGATGGG - Intergenic
1065975464 10:30838048-30838070 TTATCCAGTCTACCATTGATGGG - Intronic
1066228768 10:33411515-33411537 TTATCTGGTCTATCATTGATGGG + Intergenic
1066271344 10:33827301-33827323 TTATCTAGTCTATCATTGATGGG - Intergenic
1066271659 10:33830058-33830080 TTATCCGGTCTATCATTGATGGG - Intergenic
1066422046 10:35272655-35272677 TTATCCAGTCTACCATTGATGGG + Intronic
1066525667 10:36276504-36276526 TTATCTAGTCTATCATTGATGGG - Intergenic
1068053101 10:51977356-51977378 TTATCCAGTCTACCATTGATGGG + Intronic
1068146700 10:53080779-53080801 TTATCTAGTCCACCATTGATGGG + Intergenic
1068147161 10:53086705-53086727 TTATCCGGTCTATCATTGATGGG + Intergenic
1068218766 10:54016485-54016507 TTATTTAGTCTACCATTGATGGG - Intronic
1068366425 10:56056223-56056245 TTATCTAGTCTATCATTGATGGG + Intergenic
1068384758 10:56311319-56311341 TTATCCAGTCTACCATTGATAGG - Intergenic
1068398414 10:56494996-56495018 TAATCTAGTCTATCATTGATGGG - Intergenic
1068516498 10:58031659-58031681 TTATCTAGTCTATCATTGATGGG + Intergenic
1068676578 10:59775754-59775776 TTATCTAGTCTATCATTGATGGG - Intergenic
1068702788 10:60037679-60037701 TTATCCAGTCTACCATTGATGGG + Intronic
1069233412 10:66040482-66040504 TTATCTAGTATACCATTGATGGG - Intronic
1069942957 10:71967559-71967581 TTATCTGGTCTACCGTTGATGGG + Intronic
1070413490 10:76166704-76166726 TTATCTAGTCTACCATTCATGGG + Intronic
1071192214 10:83114517-83114539 TTATCCAGTCTACCATTGATAGG - Intergenic
1071203303 10:83245569-83245591 TTATCTAGTCTATCATTGATGGG - Intergenic
1071750493 10:88470368-88470390 TTCTCCAGTCTACCATTGATGGG - Intronic
1071881726 10:89906179-89906201 TTTTCCAGTCTACCATTGATGGG + Intergenic
1072031067 10:91523024-91523046 TTGTCCAGTCTATCATTGATGGG - Intergenic
1072091178 10:92129096-92129118 TTATCCAGTCTACCATTGATAGG - Intronic
1072201585 10:93164340-93164362 TTATCTAGTCTATCATTGATAGG + Intergenic
1072406543 10:95159529-95159551 TTGTCCAGTCTATCATTGATGGG - Intergenic
1072479783 10:95799530-95799552 TTATCTGGTCTATGATTGATGGG + Intronic
1072866972 10:99073231-99073253 TTGTCCAGTCTATCATTGATGGG - Intronic
1073232110 10:101980815-101980837 TGATCCAGTCTATCATTGATGGG - Intronic
1073627683 10:105116640-105116662 TAATCTAGTCTACCATTGATGGG - Intronic
1073639296 10:105233794-105233816 TTATCCAGTCTACCATTGATGGG + Intronic
1073652319 10:105374546-105374568 TTATCCAGTCTACCATTGATGGG + Intergenic
1073955556 10:108867359-108867381 TTATCCAGTCTACCATTGATGGG - Intergenic
1073968914 10:109024487-109024509 TTATCTAGTCTATCATTGATGGG - Intergenic
1074147283 10:110728036-110728058 TGATCCAGTCTATCATTGATGGG + Intronic
1074167390 10:110895465-110895487 TTGTCTAATCCACCATTGATGGG + Intronic
1074306304 10:112281730-112281752 TTATCTGCTCTATCATTGATGGG - Intergenic
1074628933 10:115227672-115227694 TAATCTAATCTACCATTGATGGG - Intronic
1074662195 10:115673337-115673359 TCTTCCAGTCTACCATTGATAGG + Intronic
1074746207 10:116535079-116535101 TAATCCAGTCTACCATTGATGGG + Intergenic
1075525194 10:123178524-123178546 TTATCTAGTCTATCATTGATGGG - Intergenic
1075596763 10:123737196-123737218 TTATCCAGTCTACCATTGATGGG + Intronic
1075649805 10:124119981-124120003 TTGTCTGGTTTATCAGTGATGGG - Intergenic
1076074245 10:127520678-127520700 TTATCCAGTCTACCATTGATGGG - Intergenic
1077528365 11:3082754-3082776 TTATCTGGTCTACCATTGATGGG + Intergenic
1077563292 11:3279618-3279640 TGATCCAGTCTATCATTGATAGG + Intergenic
1077569185 11:3325434-3325456 TGATCCAGTCTATCATTGATAGG + Intergenic
1078647471 11:13154628-13154650 TTATCCAGTCTACCATTGATGGG + Intergenic
1079254650 11:18817654-18817676 TTATCTAGTCTACCATCGATGGG + Intergenic
1079705863 11:23617355-23617377 TTATCCAGTCTACCATTGATGGG - Intergenic
1079971175 11:27037625-27037647 TTATCCAGTCTACCATTGATGGG - Intergenic
1079980496 11:27146687-27146709 TTATCTGGTCTATCCTTGATGGG - Intergenic
1080071070 11:28087472-28087494 TTATCTAGTCTATCATTGATGGG + Intronic
1080193636 11:29581662-29581684 TTATCCAGTCTACCATTGATGGG - Intergenic
1080218420 11:29872149-29872171 TTATCCAGTCTACCATTGATGGG + Intergenic
1080973870 11:37311426-37311448 TTGTCCAGTCCACCATTGATGGG + Intergenic
1081173887 11:39902188-39902210 TTATCTAGTCTATCATTGATGGG - Intergenic
1081268777 11:41058813-41058835 TTATCCAGTCTACCATTGATGGG - Intronic
1081269943 11:41071008-41071030 TTATCTGGTCTAACATTGATGGG - Intronic
1081306050 11:41513488-41513510 TTATCTAGTCTATCATTGATAGG + Intergenic
1081443569 11:43107294-43107316 TTATCCAGTCTACCATTGATGGG + Intergenic
1081453003 11:43191346-43191368 TTATCTAGTCTACCATTGATGGG + Intergenic
1082098546 11:48151831-48151853 TAGTCCAGTCTATCATTGATGGG + Intronic
1082249803 11:49965587-49965609 TTATCGAGTCTACCATTGATGGG - Intergenic
1082560874 11:54619126-54619148 TTATCGAGTCTACCATTGATGGG + Intergenic
1082885141 11:58074037-58074059 TTATCTAGTCTATCATTGATGGG + Intronic
1082905441 11:58303046-58303068 TTGTCTAGTCTATCATTGATGGG + Intergenic
1082981431 11:59126992-59127014 TTATCCAGTCTACCATTGATGGG - Exonic
1083022338 11:59519808-59519830 TCATCTAGTCCACCATTGATGGG - Intergenic
1083042635 11:59702345-59702367 TTATCTAGTCTATCATTGATGGG + Intergenic
1083097787 11:60269287-60269309 TTTTCCAGTCTACCATTGATGGG + Intergenic
1083499012 11:63086291-63086313 TTATCCAGTCTACCATTGATGGG - Intronic
1083511861 11:63216478-63216500 TGGTCCAGTCTATCACTGATGGG - Intronic
1084439341 11:69162857-69162879 TTATCCAGTCTACCATTGATGGG + Intergenic
1084863707 11:72039418-72039440 AGGTCTGGTGTTCCCTTGATGGG - Intronic
1084984680 11:72858373-72858395 TTATCCAGTCTACCATTGATGGG - Intronic
1085223208 11:74894002-74894024 TCATCCAGTCTACCATTGATTGG - Intronic
1085611068 11:77949973-77949995 TTGTCCAGTCTATCATTGATGGG - Intronic
1085861052 11:80236466-80236488 TTATCCAGTCTACCATTGATGGG - Intergenic
1086040012 11:82464782-82464804 TTATCCGATCTACCATTGATGGG + Intergenic
1086160068 11:83712265-83712287 TTATCTAGTCTATCATTGATGGG - Intronic
1086233063 11:84593400-84593422 TTTTCTAGTCTATCATTGATGGG - Intronic
1086271595 11:85073852-85073874 TTATCCAGTCTACCATTGATGGG - Intronic
1086497034 11:87415036-87415058 ATGTCTAGTCTATCATTGATGGG - Intergenic
1086768308 11:90727892-90727914 TTATCCAGTCTACCATTGATGGG + Intergenic
1087112714 11:94488558-94488580 TTATCCAGTCTACCATTGATGGG - Intronic
1087282407 11:96226279-96226301 TTGTCTGGTCTGGCATTGTTTGG - Intronic
1087287914 11:96286080-96286102 TTATCCAGTCTACCATTGATGGG - Intronic
1087363687 11:97193003-97193025 TTATCTAGTCTATCATTGATGGG + Intergenic
1087495367 11:98884422-98884444 TTATCTAGTCCACCATTGATGGG - Intergenic
1087830466 11:102814264-102814286 TTATCTAGTCTATCATTGATGGG + Intergenic
1087904087 11:103675509-103675531 TTATCCGGTCTATCATTGATGGG - Intergenic
1087937098 11:104047125-104047147 TCGTCCAGTCTATCATTGATGGG + Intronic
1087968284 11:104447027-104447049 TCATCTGTTCTATCATTGATGGG + Intergenic
1088077790 11:105873307-105873329 TAATCCAGTCTACCATTGATGGG + Intronic
1088122611 11:106387732-106387754 TGATCCAGTCTATCATTGATGGG + Intergenic
1088161206 11:106873154-106873176 TTATCCGGTCTATCATTGATGGG + Intronic
1088161596 11:106878382-106878404 TTATCCAGTCTACCATTGATGGG - Intronic
1088174743 11:107039769-107039791 TTATCTAGTCTATCATTGATGGG - Intergenic
1088218194 11:107537310-107537332 TGTTCTAGTCTATCATTGATGGG - Intronic
1088292592 11:108256902-108256924 TTATCCGGTCTATCATTGATGGG + Intronic
1088505944 11:110527017-110527039 TTATCCAGTCTACCATTGATGGG + Intergenic
1088552782 11:111031008-111031030 TTATCCAGTCTACCATTGATGGG - Intergenic
1088676570 11:112199343-112199365 TTGTCCAGTCTATCATTGATGGG + Intronic
1090992347 11:131829571-131829593 TTATCTGATCCACCATTGATAGG + Intronic
1091849956 12:3687582-3687604 TTATCCAGTCTACCATTGATGGG + Intronic
1092076698 12:5679893-5679915 TTATCTAGTCTATCATTGATGGG - Intronic
1092393659 12:8104961-8104983 TTATCCAGTCTACCATTGATGGG + Intergenic
1092512864 12:9176064-9176086 TTGTCCAGTCTATCATTGATGGG - Intronic
1092579798 12:9826626-9826648 TTATCCAGTCTACCATTGATGGG - Intergenic
1093016077 12:14156010-14156032 TTATCTGATCCACCATTGATGGG - Intergenic
1093076630 12:14765568-14765590 TTATCTAGTCCACCATTGATGGG - Intergenic
1093315359 12:17643513-17643535 TAGACTGGTCTACCATGTATAGG - Intergenic
1093361535 12:18235229-18235251 TTATCTAGTCTATCATTGATGGG + Intronic
1093402784 12:18766596-18766618 TTATCTAGTCTATCATTGATGGG - Intergenic
1093415766 12:18918892-18918914 TTATCTAGTCTATCATTGATGGG - Intergenic
1093483203 12:19626286-19626308 TTGTCTGGTCTACCATGAATGGG + Intronic
1093500741 12:19809258-19809280 TTATCTGATCTACCATTGATAGG - Intergenic
1093554538 12:20454857-20454879 TTATCCAGTCTACCATTGATGGG + Intronic
1094156221 12:27339345-27339367 TTTTCTAGTCTACCATTTATGGG + Intronic
1094176255 12:27544990-27545012 TTATCTAGTCTATCATTGATGGG - Intronic
1094224540 12:28030427-28030449 TTATCCAGTCTACCATTGATGGG - Intergenic
1094430921 12:30368344-30368366 TTATCCAGTCTACCATTGATAGG + Intergenic
1094464651 12:30739159-30739181 TTATCTGGTCTATCATTGATGGG - Intronic
1095119849 12:38404288-38404310 TTATCTAGTCTATCATTGATGGG + Intergenic
1095273502 12:40250893-40250915 TTATCTAGTCTATCATTGATGGG + Intronic
1095395676 12:41759596-41759618 TTATCCGGTCTATCATTGATGGG + Intergenic
1095571690 12:43690287-43690309 TTATCCAGTCTACCATTGATGGG - Intergenic
1095677744 12:44939026-44939048 TTATCCAGTCTACCATTGATGGG + Intergenic
1095703314 12:45213055-45213077 TTATCTAGTCTATCATTGATGGG + Intergenic
1096928922 12:55182622-55182644 TTATCTGGTCTATCATTGATGGG - Intergenic
1096933000 12:55236684-55236706 TTATCCAGTCTACCATTGATGGG - Intergenic
1096963594 12:55605458-55605480 TTATCTAGTCTGCCATTGATGGG - Intergenic
1097135256 12:56847740-56847762 TTATCCAGTCTACCATTGATGGG + Intergenic
1097419324 12:59354451-59354473 TTATCTGGTCTATCACTGATGGG + Intergenic
1097470618 12:59986556-59986578 TGATCCAGTCTATCATTGATGGG - Intergenic
1097762842 12:63488500-63488522 TCATCTAGTCTATCATTGATGGG + Intergenic
1098402973 12:70093303-70093325 TTATCCGGTCTACCGTTGATGGG - Intergenic
1098641600 12:72845133-72845155 TTCTCCAGTCTACCATTGATGGG - Intergenic
1099058193 12:77871672-77871694 TTGTCCAGTCTATCATTGATGGG + Intronic
1099228426 12:79995593-79995615 TTATCCAGTCTACCATTGATGGG + Intergenic
1099238207 12:80107705-80107727 TTATCTAGTCTACCACTGATGGG - Intergenic
1099866051 12:88282564-88282586 TTATCCAGTCTACCATTGATGGG - Intergenic
1099922827 12:88980413-88980435 TTATCCAGTCTACCATTGATGGG + Intergenic
1100115440 12:91297518-91297540 TTATTTAGTCTACCATTGATGGG + Intergenic
1100147447 12:91695664-91695686 TTATCTAGTCTAACATTGATGGG + Intergenic
1100266816 12:92985142-92985164 TTATCTAGTCTACCATTGATGGG - Intergenic
1100648358 12:96556658-96556680 TTATCCAGTCTACCATTGATGGG - Intronic
1100926554 12:99555043-99555065 TTATCCAGTCTACCATTGATAGG + Intronic
1100950506 12:99843642-99843664 TTATCTAGTCTATCATTGATGGG + Intronic
1100962282 12:99975953-99975975 TTGTCCAGTCTACCATTGATGGG - Intronic
1101075161 12:101121468-101121490 CTATCTGGTCCACCATTGATGGG + Intronic
1101251738 12:102943667-102943689 TTATCCAGTCTACCATTGATGGG - Intronic
1101263317 12:103057586-103057608 TTATCTAGTCTATCATTGATGGG + Intergenic
1101596367 12:106169196-106169218 TTATCTAGTCTATCATTGATGGG - Intergenic
1102380051 12:112457402-112457424 TTATCCGGTCTATCATTGATGGG + Intronic
1102660365 12:114521926-114521948 TTATCTAGTCTACCATTGATGGG - Intergenic
1103128885 12:118449261-118449283 TTATCTGGCCTAACATTGATGGG + Intergenic
1103193430 12:119021814-119021836 TTATCTAGTCTATCATTGATGGG + Intronic
1103275341 12:119706673-119706695 TTATCCAGTCTACCATTGATGGG + Intronic
1103748946 12:123145908-123145930 TTTTCCAGTCTACCATTGATGGG - Intronic
1104067649 12:125318749-125318771 TTATCCAGTCTACCATTGATGGG + Intronic
1104176924 12:126342006-126342028 TTATCTAGTCTACTATTGATGGG + Intergenic
1104221679 12:126790671-126790693 TTATCCAGTCTACCATTGATGGG - Intergenic
1104457297 12:128925570-128925592 TGATCCAGTCTATCATTGATGGG + Intronic
1104768197 12:131344226-131344248 TGGACTGGTTTAACATTGAGTGG + Intergenic
1105384403 13:19916468-19916490 TAATCCAGTCTACCATTGATGGG - Intergenic
1105716635 13:23072138-23072160 TTATCCAGTCTACCATTGATGGG + Intergenic
1105824425 13:24109343-24109365 TAATCCGGTCTATCATTGATGGG + Intronic
1106271544 13:28159207-28159229 TTATCTGGTCTACCATTGATGGG - Intronic
1106948801 13:34859675-34859697 TTATCAGGTCTATCATTGATGGG - Intergenic
1107047145 13:36005771-36005793 TTGTCCAGTCTATCATTGATGGG - Intronic
1107054318 13:36086855-36086877 TTATCTAGTCTATCATTGATGGG + Intronic
1107123102 13:36816671-36816693 TTATTTAGTCTACCATTGATGGG - Intergenic
1107208045 13:37819433-37819455 TTATTTGGTCTATCATTGATGGG - Intronic
1108136349 13:47366595-47366617 TTGTCCAGTCTATCATTGATGGG + Intergenic
1108263714 13:48683114-48683136 TTATCCAGTCTACCATTGATGGG + Intronic
1108576541 13:51796211-51796233 TCATCTGGTCTACCTTTGGTAGG - Intronic
1108629444 13:52267249-52267271 TTATCTGATCTATCATTGATGGG + Intergenic
1108656611 13:52539239-52539261 TTATCTGATCTATCATTGATGGG - Intergenic
1108756693 13:53511564-53511586 TTATCTAGTCTACCATTCATGGG + Intergenic
1108759715 13:53547870-53547892 TTATCTAGTCCACCATTGATGGG + Intergenic
1108858603 13:54826119-54826141 TTATGTGGTCTATCATTGATGGG - Intergenic
1108896024 13:55330093-55330115 TTATCAGGTCTATCATTGATGGG - Intergenic
1108941064 13:55953372-55953394 TTATCCAGTCTACCATTGATGGG - Intergenic
1109568487 13:64152619-64152641 TTATCTAGTCTATCATTGATGGG + Intergenic
1109629090 13:65020223-65020245 TTATCAAGTCTACCATTGATAGG + Intergenic
1109899882 13:68753680-68753702 TTATCTAGTCTATCATTGATGGG - Intergenic
1110567279 13:76968848-76968870 TTATCTAGTCTATCATTGATGGG + Intergenic
1110803677 13:79730093-79730115 TTATCCAGTCTACCATTGATGGG + Intergenic
1111000624 13:82175248-82175270 TTATCTAGTCCACCATTGATGGG - Intergenic
1111017890 13:82405004-82405026 TTATCTGGTCTATCATTGATGGG - Intergenic
1111147672 13:84205681-84205703 TTATCTAGTCTATCATTGATGGG + Intergenic
1111183621 13:84700078-84700100 TTTTCTAGTCTATCATTGATGGG - Intergenic
1111313658 13:86522481-86522503 TTATCTGGTCTACCATTTATGGG - Intergenic
1111348829 13:86999415-86999437 TTATCTAGTCTATCATTGATGGG - Intergenic
1111359988 13:87163437-87163459 TTATCTAGTCTATCATTGATAGG - Intergenic
1111439958 13:88268561-88268583 TTGCCTAGTCTACCATCGATGGG - Intergenic
1111474632 13:88727863-88727885 TTATCTAGTCTATCATTGATGGG + Intergenic
1111621873 13:90734670-90734692 TTATCTAGTCTATCATTGATGGG + Intergenic
1112608998 13:100937572-100937594 TTATCCAGTCTACCATTGATGGG + Intergenic
1112807333 13:103177217-103177239 TTATCTAGTCTATCATTGATGGG + Intergenic
1112890994 13:104231211-104231233 TTATATAGTCTACCATTGATGGG + Intergenic
1112913326 13:104516806-104516828 TTATCCGGTCTACTATTGATGGG + Intergenic
1112958465 13:105091101-105091123 TTATCTAGCCTACCATTGATGGG + Intergenic
1113362448 13:109643910-109643932 TTATCCAGTCTACCATTGATAGG + Intergenic
1113694731 13:112336447-112336469 TTGTCTAGTCTATCATTGATGGG - Intergenic
1113967095 13:114159119-114159141 TTGTCCAGTCTATCATTGATGGG + Intergenic
1114127964 14:19752817-19752839 TTATCTAGTCTACCATTTATGGG - Intronic
1114147214 14:19992035-19992057 TTATCCAGTCTACCATTGATGGG - Intergenic
1114148335 14:20005308-20005330 TTGTCCAGTCTATCATTGATTGG + Intergenic
1114159643 14:20150148-20150170 TTGTCTATTGTACCATTGATGGG - Intergenic
1114582111 14:23771505-23771527 TTATCCAGTCTACCATTGATGGG + Intergenic
1114741272 14:25100273-25100295 TTATCCAGTCTACCATTGATGGG - Intergenic
1114843415 14:26292179-26292201 TTATCTAGTCTACCATTGAAGGG + Intergenic
1114885836 14:26849879-26849901 TTATCCAGTCTACCATTGATGGG + Intergenic
1114921813 14:27342148-27342170 TTATCTAGTCTATCATTGATGGG - Intergenic
1115008634 14:28517454-28517476 TTATCTTGTCTATCATTGATGGG + Intergenic
1115013433 14:28579006-28579028 TTATCCGGTCTACCATTGCTGGG + Intergenic
1115045214 14:28983715-28983737 TTATCCAGTCTACCATTGATGGG - Intergenic
1115056308 14:29132099-29132121 TTATCCGGTCTATCATTGATGGG - Intergenic
1115481011 14:33860933-33860955 TTATCTAGTCTATCATTGATGGG + Intergenic
1115511855 14:34145718-34145740 TTATCTAGTCTAACATTGATGGG - Intronic
1116043143 14:39710485-39710507 TTATCCTGTCTACCATTGATGGG - Intergenic
1116073747 14:40083936-40083958 TTATCCAGTCTACCATTGATGGG - Intergenic
1116073923 14:40085965-40085987 TTGTCCAGTCTATCATTGATGGG + Intergenic
1116267563 14:42713498-42713520 TTATCCAGTCTACCATTGATGGG - Intergenic
1116380931 14:44267020-44267042 TTATCTAGTCTATCATTGATGGG - Intergenic
1116429162 14:44826224-44826246 TTATCCAGTCTACCATTGATGGG - Intergenic
1116536353 14:46035963-46035985 TTATCCAGTCTACCATTGATGGG - Intergenic
1116558663 14:46347346-46347368 TCATCCTGTCTACCATTGATTGG - Intergenic
1116568615 14:46485782-46485804 AAATCTAGTCTACCATTGATGGG + Intergenic
1116575402 14:46568038-46568060 TTATCTGGTTTATCATTGATGGG + Intergenic
1116692760 14:48131428-48131450 TTATCAGGTCTATCATTGATGGG + Intergenic
1116724856 14:48550207-48550229 TTATCTAGTCCACCATTGATGGG - Intergenic
1116758394 14:48978433-48978455 TTATCCGGTCTATCATTGATAGG + Intergenic
1116765662 14:49067525-49067547 TTATCCGGTCTATCATTGATGGG - Intergenic
1117272119 14:54155182-54155204 TTATCTAGTCTACCACTGATGGG + Intergenic
1117467606 14:56008886-56008908 TTATCTAGTCTATCATTGATGGG + Intergenic
1117561353 14:56942484-56942506 TTATCCAGTCTACCATTGATGGG + Intergenic
1118045159 14:61961872-61961894 TTATCAAGTCTACCATTGATGGG - Intergenic
1118614849 14:67568200-67568222 TTATCCAGTCTACCATTGATGGG - Intronic
1118948403 14:70410620-70410642 TTGTCCAGTCTACCATTGATGGG - Intronic
1118958779 14:70508235-70508257 TTATCTAGTCTATCATTGATGGG - Intergenic
1118997683 14:70851805-70851827 TTATCTAATCTACCATTGATGGG + Intergenic
1119876851 14:78067325-78067347 TTATCCAGTCTACCATTGATGGG + Intergenic
1119987018 14:79149612-79149634 TTGTCCAGTCTATCATTGATGGG - Intronic
1119993049 14:79221138-79221160 TTATCTAGTCTATCATTGATGGG + Intronic
1120021567 14:79536844-79536866 TTGTCCAGTCTATCATTGATGGG + Intronic
1120064036 14:80018750-80018772 TTATCCAGTCTACCATTGATGGG + Intergenic
1120114247 14:80595080-80595102 TTATCTAGTCTATCATTGATGGG - Intronic
1120252780 14:82079378-82079400 TTATCCAGTCTACCATTGATGGG + Intergenic
1120449566 14:84650020-84650042 TTATCTAGTCTAACATTGATGGG + Intergenic
1120663372 14:87277219-87277241 TTATCCAGTCTACCATTGATGGG + Intergenic
1120723332 14:87910980-87911002 TAATCCAGTCTACCATTGATGGG + Intronic
1120816025 14:88859272-88859294 TTATCCGGTCTACCACTGATGGG - Intronic
1121155303 14:91677831-91677853 TTATCCCGTCTACCATTGATGGG - Intronic
1121707335 14:96008025-96008047 TTGTCCAGTCTATCATTGATGGG - Intergenic
1121731608 14:96191238-96191260 TTATCCAGTCTACCATTGATGGG + Intergenic
1123607534 15:22049716-22049738 TTATCTAGTCTACCATTTATGGG - Intergenic
1123670070 15:22647644-22647666 TTTTCTAGTCTATCATTGATGGG - Intergenic
1123737251 15:23197376-23197398 TTATCCAGTCTACCATTGATGGG - Intergenic
1123806167 15:23876229-23876251 TTATCTAGTCCACCATTGATGGG - Intergenic
1123979294 15:25584834-25584856 TTATCCAGTCTACCATTGATGGG + Intergenic
1123983876 15:25627086-25627108 TTATCCAGTCTACCATTGATAGG + Intergenic
1124034654 15:26044128-26044150 TTATCCAGTCTACCATTGATGGG + Intergenic
1124288468 15:28426038-28426060 TTATCCAGTCTACCATTGATGGG - Intergenic
1124294758 15:28491276-28491298 TTATCCAGTCTACCATTGATGGG + Intergenic
1124526043 15:30454060-30454082 TTTTCTAGTCTATCATTGATGGG - Intergenic
1124704322 15:31949244-31949266 TTATCCAGTCTACCATTGATGGG + Intergenic
1124772611 15:32553625-32553647 TTTTCTAGTCTATCATTGATGGG + Intergenic
1125048967 15:35275307-35275329 TTATCCAGTCTACCATTGATGGG - Intronic
1125076036 15:35619624-35619646 TTATCTAGTCTATCATTGATAGG + Intergenic
1125078227 15:35645974-35645996 TTATCAAGTCTACCATTGATGGG - Intergenic
1125127856 15:36245356-36245378 TTATCCAGTCTACCATTGATGGG - Intergenic
1125273803 15:37969908-37969930 TTATCCTGTCTACCATTGATGGG + Intergenic
1126486299 15:49185364-49185386 TTATCCAGTCTACCATTGATAGG + Intronic
1126809275 15:52384198-52384220 TGGCCTGGTCTGCCTTTGGTGGG + Exonic
1126897935 15:53279891-53279913 TTATCTGGTTTATCATTGATGGG + Intergenic
1126946219 15:53823368-53823390 TGGTCTGGTCTCTCATGGCTAGG + Intergenic
1127003494 15:54538601-54538623 TTATCCAGTCTACCATTGATGGG - Intronic
1127011049 15:54629042-54629064 TTATCTGGTCTACTGTTGATGGG - Exonic
1127096909 15:55520911-55520933 TTATCCAGTCTACCATTGATGGG + Intergenic
1127103909 15:55593144-55593166 TTATCTGGTCTATCATTGATGGG - Intergenic
1127168780 15:56276563-56276585 TTATCTAGTCTATCATTGATGGG + Intronic
1127521632 15:59748795-59748817 TTGTCCAGTCTATCATTGATGGG - Intergenic
1127709885 15:61586382-61586404 TTATCCAGTCTACCATTGATGGG - Intergenic
1129045891 15:72733658-72733680 TTATCCAGTCTACCATTGATGGG + Intronic
1129135715 15:73548790-73548812 TTTTCTAGTCTATCATTGATGGG - Intronic
1129583544 15:76838156-76838178 TTATCCAGTCTACCATTGATGGG - Intronic
1130451829 15:84062551-84062573 TTATCTGATCCACCATTGATGGG + Intergenic
1130810788 15:87376397-87376419 TTATCTAGTCCACCATTGATGGG - Intergenic
1130820719 15:87492196-87492218 TTATCTAGTCTACCACTGATGGG + Intergenic
1131319368 15:91371349-91371371 TTATCCAGTCTACCATTGATAGG + Intergenic
1131415991 15:92258390-92258412 TTATCCGGTCTATCATTGATAGG - Intergenic
1131568587 15:93508303-93508325 TTATCTGTTCTATCATTGATGGG + Intergenic
1131740042 15:95379422-95379444 TTATCTAGTCTATCATTGATGGG - Intergenic
1131759334 15:95602997-95603019 TTATCCAGTCTACCATTGATGGG + Intergenic
1202979770 15_KI270727v1_random:341518-341540 TTATCTAGTCTACCATTTATGGG - Intergenic
1133526068 16:6606742-6606764 TTATCTGGTCTATCATTGATGGG + Intronic
1133719287 16:8479458-8479480 TTATCCAGTCTACCATTGATGGG - Intergenic
1133917205 16:10119968-10119990 TTATCCAGTCTACCATTGATGGG + Intronic
1134205379 16:12233194-12233216 TTATCCAGTCTACCATTGATGGG - Intronic
1134297540 16:12960522-12960544 TTATCTAGTCTATCATTGATGGG - Intronic
1134300613 16:12987350-12987372 TTGTCCAGTCTATCATTGATGGG - Intronic
1134789667 16:16978149-16978171 TTATCCAGTCTACCATTGATGGG - Intergenic
1134790572 16:16985830-16985852 TTATCCAGTCTACCATTGATGGG - Intergenic
1135978315 16:27126080-27126102 TTATCTGCTCTATCATTGATTGG - Intergenic
1136348188 16:29690262-29690284 TTGTCCAGTCTAGCATTGATGGG + Intronic
1137239813 16:46646588-46646610 TAATCCAGTCTACCATTGATGGG - Intergenic
1137954310 16:52813686-52813708 TTATCTAGTCTATCATTGATGGG - Intergenic
1138162479 16:54767549-54767571 TTATCCAGTCTACCATTGATGGG + Intergenic
1138176011 16:54898828-54898850 TTATCTAGTCTATCATTGATGGG + Intergenic
1138695146 16:58806150-58806172 TTATCCAGTCTACCATTGATGGG - Intergenic
1138729668 16:59181217-59181239 TCATCTAGTCTACCATTGATGGG + Intergenic
1138749460 16:59401537-59401559 TGGTCTTTTCTACTATTGTTTGG + Intergenic
1138754592 16:59468199-59468221 TTATCCAGTCTACCATTGATGGG + Intergenic
1138921732 16:61538665-61538687 TTATCCAGTCTACCATTGATGGG - Intergenic
1139113712 16:63923636-63923658 TTATCAGGTCAACCATTGATGGG - Intergenic
1140008666 16:71107923-71107945 TTATCCAGTCTACCATTGATGGG - Intronic
1140255961 16:73336622-73336644 TTATCTAGTCTACCACTGATGGG + Intergenic
1140342538 16:74179164-74179186 TTATCCAGTCTACCATTGATGGG - Intergenic
1140414481 16:74764324-74764346 TTATCCAGTCTACCATTGATGGG - Intronic
1140636619 16:76922395-76922417 TAATCTAGTCTACCATTGATGGG + Intergenic
1140667702 16:77242745-77242767 TTATCTAGTCTATCATTGATGGG + Intergenic
1140669606 16:77264167-77264189 TTATCTAGTCTATCATTGATGGG + Intronic
1140954736 16:79851952-79851974 TTATCTAGTCTATCATTGATAGG + Intergenic
1141276159 16:82590086-82590108 TTATCTAGTCTACCATTGACGGG + Intergenic
1141285877 16:82671277-82671299 TGGTGTGGTCTTCCTTTGTTTGG + Intronic
1141347201 16:83257653-83257675 TTATCGTGTCTACCATTGATGGG + Intronic
1142965558 17:3578781-3578803 TTATCCAGTCTACCATTGATGGG - Intronic
1143283013 17:5768860-5768882 TTATCTAGTCTATCATTGATGGG - Intergenic
1143710513 17:8731506-8731528 TTATCCAGTCTACCATTGATGGG - Intronic
1143722932 17:8826383-8826405 TTGTCCTGTCTATCATTGATGGG - Intronic
1143821399 17:9566878-9566900 CTGTCTGGTCTACCATTGGTGGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144095141 17:11893471-11893493 TTATCCAGTCTACCATTGATGGG - Intronic
1144137323 17:12309318-12309340 TTATCCAGTCTACCATTGATAGG + Intergenic
1144231672 17:13211605-13211627 TTATCTAGTCTATCATTGATGGG - Intergenic
1146505689 17:33402672-33402694 TTATCTAGTCTATCATTGATGGG + Intronic
1146556386 17:33828109-33828131 TTATCCGGTCTATCATTGATGGG + Intronic
1146931337 17:36780259-36780281 TGGTCTGGTTGAGCACTGATAGG - Intergenic
1147494876 17:40906070-40906092 TTATCTGGTCTATCATTGATGGG + Intergenic
1148982140 17:51586391-51586413 TTATCTAGTCTATCATTGATAGG + Intergenic
1149025364 17:52021038-52021060 TTATCCAGTCTACCATTGATGGG + Intronic
1149063884 17:52457597-52457619 TTATCTAGTCTATCATTGATAGG - Intergenic
1149142087 17:53443670-53443692 TTATCTAGTCTACCATTGATGGG - Intergenic
1149232024 17:54545421-54545443 TTATCCAGTCTACCATTGATGGG - Intergenic
1149247959 17:54733743-54733765 TTATCCAGTCTACCATTGATGGG - Intergenic
1149716410 17:58794798-58794820 TTATCCAGTCTACCATTGATAGG + Intronic
1149721244 17:58846655-58846677 TAATCCAGTCTACCATTGATGGG + Intronic
1149948074 17:60953000-60953022 TTATCTAGTCTGCCATTGATAGG + Intronic
1150172701 17:63016462-63016484 TGGTCTGTTCTTCCTTTGATGGG + Intronic
1150321826 17:64220957-64220979 TAGTCCAGTCTATCATTGATGGG - Intronic
1150427597 17:65088908-65088930 TTGTCTAGTCATCCATTGATGGG + Intergenic
1154296008 18:13148970-13148992 TTATCTAGTCTAGCATTGATGGG + Intergenic
1154381100 18:13850628-13850650 TTGTCCAGTCTACCATTGATGGG - Intergenic
1155102297 18:22623521-22623543 TTATCCGGTCTATCATTGATGGG + Intergenic
1155115703 18:22764549-22764571 TTGTCCAGTCTATCATTGATGGG - Intergenic
1155180783 18:23344241-23344263 TTATCCAGTCTACCATTGATGGG + Intronic
1155582705 18:27328618-27328640 TTATCCAGTCTACCATTGATGGG - Intergenic
1155627780 18:27854524-27854546 TTATCTAGTCTACCACTGATGGG + Intergenic
1155657272 18:28206847-28206869 TTATCCAGTCTACCATTGATGGG + Intergenic
1156085070 18:33388468-33388490 TTATCTAGTCTATCATTGATGGG - Intronic
1156374657 18:36502630-36502652 TCATCCAGTCTACCATTGATGGG + Intronic
1157008231 18:43612695-43612717 TTATCCAGTCTACCATTGATGGG + Intergenic
1157072268 18:44421978-44422000 TTATCCAGTCTACCATTGATGGG - Intergenic
1157414696 18:47492223-47492245 TTATCTAGTCTATCATTGATGGG + Intergenic
1157955669 18:52094954-52094976 TTATCTAGTCTATCATTGATGGG - Intergenic
1158776110 18:60581830-60581852 TTATCTAGTCTATCATTGATGGG + Intergenic
1159256335 18:65952279-65952301 TTGTGTGGTCTATCCTTGATGGG - Intergenic
1159404732 18:67985369-67985391 TTATCCAGTCTACCATTGATAGG + Intergenic
1159436364 18:68423184-68423206 TTGTCCAGTCTATCATTGATGGG - Intergenic
1159468004 18:68811083-68811105 TTATCCAGTCTACCATTGATGGG + Intronic
1159679705 18:71333277-71333299 TTGTCCAATCTACCATTGATGGG - Intergenic
1159751919 18:72313346-72313368 TTGTCCTGTCTACCACTGATGGG - Intergenic
1162863974 19:13529858-13529880 TTATCTAGTCTATCATTGATGGG - Intronic
1163046015 19:14642815-14642837 TTATCCAGTCTACCATTGATGGG + Intronic
1163870037 19:19813652-19813674 TTATCCAGTCTACCATTGATAGG - Intronic
1163899033 19:20084375-20084397 TTATCCAGTCTACCATTGATAGG + Intronic
1163904682 19:20142049-20142071 TGATCCAGTCTGCCATTGATAGG - Intergenic
1163957388 19:20657051-20657073 TTATCTTGTCTACCAGTGATAGG - Intronic
1163959314 19:20672460-20672482 TTATCTTGTCTACCATTGATAGG + Intronic
1164006781 19:21157092-21157114 TAATCTAGTCTACCATTAATAGG + Intronic
1164095223 19:22003852-22003874 TTATCTAGTCTACCAGTGATAGG - Intronic
1164198686 19:22998203-22998225 TTATCCAGTCTACCATTGATAGG - Intronic
1164798240 19:31053984-31054006 TTATCCAGTCTACCATTGATGGG - Intergenic
1164917679 19:32065194-32065216 TTATCCAGTCTACCATTGATGGG + Intergenic
1165052965 19:33154590-33154612 TTATCCGGTCTATCATTGATGGG + Intronic
1165254069 19:34562581-34562603 TTGTCCAGTCTATCATTGATGGG + Intergenic
1165366431 19:35370147-35370169 TTATCTAGTCCACCATTGATGGG - Intergenic
1165621112 19:37248936-37248958 TTATCCAGTCTACCATTGATGGG + Intergenic
1166904286 19:46094914-46094936 TTGTCTAGTCTATCGTTGATGGG + Intergenic
1167201774 19:48070499-48070521 TTATCCAGTCTACCATTGATGGG - Intronic
1168483858 19:56743990-56744012 TTATCTAGTCTATCATTGATGGG + Intergenic
1168521698 19:57056295-57056317 TTATCTAGTCTACCATTGATGGG - Intergenic
925320702 2:2965084-2965106 TTATCAAGTCTACCATTGATGGG - Intergenic
925441256 2:3887701-3887723 TTTTCCAGTCTACCATTGATGGG + Intergenic
925931886 2:8714666-8714688 TAGTCAGGTCTTCCATCGATTGG + Intergenic
926432345 2:12801150-12801172 TTATCCAGTCTACCATTGATGGG - Intergenic
926443892 2:12920752-12920774 TTATCTAGTCTATCATTGATGGG + Intergenic
926531842 2:14057290-14057312 TTATCTAGTCTATCATTGATGGG - Intergenic
926642342 2:15251064-15251086 TTATCTGGTTTATCATTGATGGG - Intronic
927016128 2:18963747-18963769 TAATCTAGTCTATCATTGATGGG + Intergenic
927172261 2:20380008-20380030 TTATCCAGTCTACCATTGATGGG + Intergenic
927402863 2:22733838-22733860 TAATCCAGTCTACCATTGATGGG - Intergenic
927565586 2:24110038-24110060 TTATCCTGTCTACCATTGATAGG - Intronic
927612554 2:24556378-24556400 TTGTTTAGTCTATCATTGATGGG + Intronic
928041513 2:27882683-27882705 TTATCCAGTCTACCATTGATGGG - Intronic
928346912 2:30507697-30507719 TTATCCAGTCTACCATTGATGGG + Intronic
928408648 2:31035525-31035547 TTATCCAGTCTACCATTGATGGG - Intronic
928472419 2:31587504-31587526 TTATCCAGTCTACCATTGATGGG - Intergenic
928503426 2:31922859-31922881 TTATCTAGTCTACCACTGATGGG + Intronic
928808319 2:35189572-35189594 TTATCTGGTCTATCACTGATGGG + Intergenic
929293208 2:40216389-40216411 TTATCTAGTCTATCATTGATGGG + Intronic
930302550 2:49635204-49635226 TTATTTAGTCTACCATTGATGGG + Intergenic
930307832 2:49698748-49698770 TGATCCAGTCTATCATTGATGGG - Intergenic
930350767 2:50251415-50251437 TTATCCGGTCTATCATTGATGGG + Intronic
930365586 2:50435529-50435551 TTATCTAGTCTACCCTTGATGGG + Intronic
930592116 2:53340445-53340467 TTATCCAGTCTACCATTGATGGG + Intergenic
930669915 2:54137667-54137689 TTATCCAGTCTACCATTGATGGG + Intronic
930922448 2:56773294-56773316 TGTTCTTGTCTATCATTGATGGG + Intergenic
930993813 2:57691858-57691880 TTGTCCACTCTACCATTGATGGG - Intergenic
931477139 2:62599926-62599948 TTATCTAGTCTATCATTGATGGG + Intergenic
931974096 2:67623710-67623732 TTATCTAGTCTATCATTGATGGG + Intergenic
932077146 2:68675255-68675277 TTATCTAGTCCACCATTGATGGG + Intergenic
932110997 2:69000026-69000048 TTATCTAGTCTATCATTGATGGG + Intergenic
932198661 2:69806604-69806626 TTATCCAGTCTACCATTGATGGG - Intronic
932310877 2:70739626-70739648 TTGTCCAGTCTGCCATTGATGGG - Intronic
932471115 2:71959027-71959049 TTATCTAGTCCACCATTGATGGG - Intergenic
932527322 2:72484835-72484857 TTATCTAGTCTATCATTGATGGG + Intronic
932890394 2:75590992-75591014 TTATCCAGTCTACCATTGATGGG + Intergenic
932911043 2:75806277-75806299 TTATCAGGTCTATCATTGATGGG - Intergenic
933375761 2:81478001-81478023 TTATCTAGTCTACCATTGATAGG - Intergenic
933414519 2:81969318-81969340 TTATCCAGTCTACCATTGATGGG - Intergenic
933607824 2:84402613-84402635 TTATCTAGTCTATCATTGATGGG - Intergenic
933981058 2:87551239-87551261 TTGTCCAGTCTATCATTGATGGG - Intergenic
934162543 2:89265771-89265793 TTATCTGTTCTATCATTGATGGG + Intergenic
934204730 2:89916754-89916776 TTATCTGTTCTATCATTGATGGG - Intergenic
934923074 2:98361415-98361437 TTATCTAGTCTATCATTGATGGG + Intronic
935438391 2:103062002-103062024 TTATCTAGTCTATCATTGATGGG - Intergenic
935501687 2:103848884-103848906 TTGTCTACTCTACCATTGATGGG - Intergenic
935601465 2:104926702-104926724 TTATCTAGTCTATCATTGATGGG - Intergenic
936006482 2:108893434-108893456 TGGTCTGGTCTCACATTGGAGGG - Intergenic
936256486 2:110919162-110919184 TTATCTAGTCTATCATTGATGGG - Intronic
936273474 2:111070260-111070282 TTATCCAGTCTACCATTGATGGG - Intronic
936312773 2:111399560-111399582 TTGTCCAGTCTATCATTGATGGG + Intergenic
936390607 2:112069552-112069574 TTATCCAGTCTACCATTGATGGG + Intronic
936605285 2:113946029-113946051 TTATCCAGTCTACCATTGATGGG + Intronic
937485013 2:122306589-122306611 TTATCCAGTCTACCATTGATGGG - Intergenic
939209339 2:139152722-139152744 TTATCCAGTCTACCATTGATGGG - Intergenic
939365440 2:141224577-141224599 TTATCCAGTCTACCATTGATGGG - Intronic
940063592 2:149600363-149600385 TTATCTAGTCTACCATTGACGGG - Intergenic
940282841 2:152005277-152005299 TTGTCTGATCCACCACTGATGGG - Intronic
940463462 2:153998028-153998050 TTATCAGGTCTATCATTGATGGG + Intronic
940593105 2:155754146-155754168 TTATCAGGTCTATCATTGATGGG - Intergenic
941036641 2:160575997-160576019 AGTTCTGGTCTACCTTTAATGGG - Intergenic
941239874 2:163024100-163024122 TTATCCAGTCTACCATTGATGGG + Intergenic
941267316 2:163378539-163378561 TTATCCAGTCTACCATTGATGGG + Intergenic
941608577 2:167632179-167632201 TTATCTAGTCTATCATTGATGGG + Intergenic
942050783 2:172138862-172138884 TTCTTTAGTCTACCATTGATGGG - Intergenic
942198045 2:173542440-173542462 TTCTTTAGTCTACCATTGATGGG - Intergenic
942201291 2:173574010-173574032 TTATCCTGTCTACCATTGATAGG + Intergenic
942406037 2:175656292-175656314 TTATCCAGTCTACCATTGATAGG - Intergenic
942958960 2:181806815-181806837 TTATCTAGTCTATCATTGATGGG - Intergenic
943082121 2:183267821-183267843 TTGTCCAGTCTACCATTGATAGG + Intergenic
943109077 2:183583399-183583421 TTATCCAGTCTACCATTGATAGG + Intergenic
943146658 2:184054655-184054677 TTGTCCAGTCTATCATTGATGGG + Intergenic
943368488 2:186986434-186986456 TTATCCAGTCTACCATTGATGGG + Intergenic
943504796 2:188741388-188741410 TTATCTGGTCTATTATTGATGGG + Intronic
943554617 2:189387070-189387092 TGATCCAGTCCACCATTGATGGG - Intergenic
943897918 2:193391005-193391027 TTGTTCGGTCTACCATTGATGGG + Intergenic
944118339 2:196212581-196212603 TTATCCAGTCTACCATTGATGGG + Intronic
944268408 2:197753892-197753914 TTATCTAGTCTATCATTGATGGG - Intronic
944327686 2:198426015-198426037 TGATCCAGTCTATCATTGATGGG + Intronic
944336246 2:198538787-198538809 TGATCCAGTCTATCATTGATGGG + Intronic
944347908 2:198690504-198690526 TGATCCAGTCTATCATTGATGGG - Intergenic
944355636 2:198784364-198784386 TGATCCAGTCTATCATTGATGGG + Intergenic
944371368 2:198987188-198987210 TTCTCTAGTCTACCACTGATGGG - Intergenic
944623077 2:201539051-201539073 TTATCCAGTCTACCATTGATGGG + Intronic
944849385 2:203702411-203702433 TTATCTAGTCTATCATTGATGGG - Intergenic
945341386 2:208660062-208660084 TTATCCAGTCTACCATTGATGGG + Intronic
945578130 2:211557873-211557895 TTATCCAGTCTACCATTGATGGG - Intronic
945775378 2:214100777-214100799 TCATCCAGTCTACCATTGATGGG + Intronic
946197634 2:218044826-218044848 TCATCCAGTCTACCATTGATGGG + Intronic
946778462 2:223168748-223168770 TTATCCAGTCTACCATTGATGGG - Intronic
946781759 2:223198682-223198704 TAATCCAGTCTACCATTGATGGG - Intergenic
946995987 2:225392104-225392126 TTATCTAGTCTATCATTGATGGG + Intergenic
947146968 2:227077245-227077267 TTGTCCAGTCTATCATTGATGGG - Intronic
947372735 2:229465186-229465208 TTGTCTAGTCTATCATTGACGGG - Intronic
947912785 2:233812206-233812228 TGGGCTGCTCTTCCATTGATTGG + Intronic
947977441 2:234379184-234379206 TTATCTAGTCTATCATTGATGGG + Intergenic
948071904 2:235134864-235134886 TGGTCTATTCTACCAGTGAAGGG - Intergenic
948415982 2:237804185-237804207 TTACCTGGTCTACTATTGATGGG + Intronic
948812025 2:240484069-240484091 TTATCTAGTCTATCATTGATGGG + Intronic
949081812 2:242106889-242106911 TTATCCAGTCTACCATTGATGGG + Intergenic
1168858347 20:1026455-1026477 TTATCTAGTCTATCATTGATGGG + Intergenic
1168987013 20:2058072-2058094 TTGTCTAGTCTATCACTGATGGG - Intergenic
1169319458 20:4619405-4619427 TTATCTAGTCTATCATTGATGGG + Intergenic
1169754926 20:9033588-9033610 TTGTCCAGTCTATCATTGATGGG + Intergenic
1170184018 20:13567032-13567054 TTATCCAGTCTACCATTGATGGG - Intronic
1170282091 20:14660939-14660961 TTATCTAATCTACCATTGATGGG + Intronic
1170376141 20:15702050-15702072 TTATCCAGTCTACCATTGATGGG + Intronic
1170523398 20:17212125-17212147 TTGTCCTGTCTATCATTGATGGG - Intergenic
1170664389 20:18374299-18374321 TTATCCAGTCTACCATTGATTGG - Intergenic
1170862450 20:20119999-20120021 TTATCCAGTCTACCATTGATGGG + Intronic
1171331735 20:24345796-24345818 TTATCCAGTCTACCATTGATGGG - Intergenic
1171362062 20:24593430-24593452 TTATCCAGTCTACCATTGATAGG + Intronic
1171410922 20:24948508-24948530 TTATCCAGTCTACCATTGATGGG - Intergenic
1171937775 20:31292374-31292396 TTATCCAGTCTACCATTGATGGG - Intergenic
1173412281 20:42823143-42823165 TTATCCGGTCTATCATTGATGGG - Intronic
1174683355 20:52429899-52429921 TTATCCAGTCTACCATTGATGGG - Intergenic
1174779368 20:53374376-53374398 TCATCTAGTCTACCACTGATAGG + Intronic
1174865463 20:54131359-54131381 TTGTCCAGTCTATCATTGATGGG + Intergenic
1175591506 20:60195806-60195828 TTATCTAGTCTATCATTGATGGG + Intergenic
1175685660 20:61026432-61026454 TTATCTAGTCTATCATTGATGGG + Intergenic
1176688777 21:9880027-9880049 TGGAGTGGTCAACCTTTGATGGG + Intergenic
1177043476 21:16141772-16141794 TTATCCAGTCTACCATTGATGGG + Intergenic
1177313711 21:19429907-19429929 TTATCCGGTCTATCATTGATGGG - Intergenic
1177360876 21:20068310-20068332 TTATCTAGTCTATCATTGATGGG - Intergenic
1177384521 21:20391421-20391443 TTATCTAGTCTAACATTGATGGG + Intergenic
1177586808 21:23107481-23107503 TGGTGTGGTCTATCATTTTTTGG - Intergenic
1177672943 21:24257086-24257108 TTATCCAGTCTACCATTGATGGG - Intergenic
1177688568 21:24472626-24472648 TCATCTGGTCCACCATTGATGGG + Intergenic
1177689709 21:24489611-24489633 TAGTCCAGTCTATCATTGATGGG - Intergenic
1177908490 21:27000595-27000617 TTATCCAGTCTACCATTGATGGG - Intergenic
1177963355 21:27696756-27696778 TTATCTAGTCTATCATTGATGGG + Intergenic
1177995878 21:28097083-28097105 TTATCTAGTCTATCATTGATGGG - Intergenic
1178956015 21:37022593-37022615 CTGTCCAGTCTACCATTGATGGG + Intergenic
1179034810 21:37750485-37750507 TTATCCGGTCTATCATTGATGGG - Intronic
1179157296 21:38861739-38861761 TGGCTTGGTCTACCACTGACTGG - Intergenic
1179203442 21:39248968-39248990 TTATCCAGTCTACCATTGATGGG - Intronic
1179301546 21:40115909-40115931 TTATCTAGTCTATCATTGATGGG - Intronic
1179319795 21:40279731-40279753 TGATCAAGTCTATCATTGATGGG - Intronic
1179378381 21:40874591-40874613 TTATCTAGTCTATCATTGATGGG - Intergenic
1181885073 22:26015406-26015428 TTATCCAGTCTACCATTGATGGG - Intronic
1181984276 22:26788562-26788584 TTATCTAGTCTACCATTGATGGG + Intergenic
1182020602 22:27078319-27078341 TTATCCAGTCTACCATTGATGGG + Intergenic
1182201030 22:28570312-28570334 TTATCTTGTCCACCATTGATGGG - Intronic
1182259202 22:29060818-29060840 GGGTCTCGTCTCACATTGATTGG + Exonic
1182704029 22:32263805-32263827 TTATCCAGTCTACCATTGATGGG - Intergenic
1182761689 22:32727373-32727395 TTATCCAGTCTACCATTGATGGG + Intronic
1182822166 22:33225946-33225968 TTATCCAGTCTACCATTGATGGG + Intronic
1182865261 22:33598758-33598780 TGATCCAGTCTATCATTGATGGG + Intronic
1185231072 22:49683263-49683285 TTATCCAGTCTACCATTGATAGG + Intergenic
949386859 3:3512500-3512522 TTATCCAGTCTACCATTGATGGG - Intergenic
949466476 3:4349590-4349612 TTATCCAGTCTACCATTGATGGG - Intronic
950143359 3:10630557-10630579 TTATCCAGTCTACCATTGATGGG + Intronic
950323209 3:12077705-12077727 TTATCTGGTCTATCCTTGATGGG + Intronic
950558043 3:13706921-13706943 GAGGCTGGTCTACCATTGAGGGG + Intergenic
950558498 3:13708948-13708970 GAGGCTAGTCTACCATTGATGGG + Intergenic
950558693 3:13709850-13709872 GAGGCTGGTCTACCATTGAGGGG + Intergenic
950559640 3:13714198-13714220 GAGGCTGGTCTACCATTGAGGGG + Intergenic
950559819 3:13714943-13714965 GAGGCTGGTCTGCCATTGATGGG + Intergenic
950559872 3:13715179-13715201 TAGGCTGGTTTACCATTGAGTGG + Intergenic
950559911 3:13715359-13715381 GAGGCTGGTCTACCATTGATGGG + Intergenic
950559952 3:13715543-13715565 GAGGCTGGTCTACCATTGACAGG + Intergenic
950560000 3:13715702-13715724 GGGGCTGGTCTACCATTGGGGGG + Intergenic
950866567 3:16194586-16194608 TTATCTAGTCTATCATTGATGGG - Intronic
951341946 3:21499234-21499256 TTATCCAGTCTACCATTGATGGG - Intronic
951499308 3:23366412-23366434 TTATCTGGTCTACCACTGATGGG - Intronic
951750796 3:26034043-26034065 TAATCTAGTCTATCATTGATTGG + Intergenic
951957187 3:28270144-28270166 TTATCTGGTCTATCATGGATGGG + Intronic
951979776 3:28552484-28552506 TTATCCAGTCTACCATTGATGGG + Intergenic
952481443 3:33765871-33765893 TTATCTAGTCTATCATTGATGGG - Intergenic
952511472 3:34061096-34061118 TTATCTAGTCTATCATTGATGGG - Intergenic
952548081 3:34444363-34444385 TTATCTAGTCTATCATTGATGGG + Intergenic
952643168 3:35622692-35622714 TTATCCAGTCTACCATTGATGGG + Intergenic
952695639 3:36262404-36262426 TGATCCAGTCTATCATTGATGGG + Intergenic
952704156 3:36360500-36360522 TTATCCAGTCTACCATTGATGGG - Intergenic
952721613 3:36539609-36539631 TTATCCAGTCTACCATTGATGGG + Intronic
953249193 3:41228106-41228128 TTATCTAGTCTACCATTGATGGG + Intronic
954512089 3:51134165-51134187 TTATCCAGTCTACCATTGATGGG + Intronic
954522222 3:51238844-51238866 TTATCCAGTCTACCATTGATAGG + Intronic
954527738 3:51287890-51287912 TTATCTAGTCTACCACTGATGGG - Intronic
954586026 3:51737575-51737597 TTATCTAGTCTATCATTGATGGG + Intergenic
955009069 3:54996778-54996800 TTATCTAGTCTATCATTGATGGG - Intronic
955421103 3:58738574-58738596 TTGTCCAGTCTACCATTGATGGG + Intronic
955616599 3:60814592-60814614 TTATCTGATCCACCATTGATGGG + Intronic
955660239 3:61291223-61291245 TTATCCAGTCTACCATTGATGGG - Intergenic
956032297 3:65051647-65051669 TTATCCAGTCTACCATTGATGGG + Intergenic
956245039 3:67173457-67173479 TTATCTAGTCTATCATTGATAGG + Intergenic
956283317 3:67582502-67582524 TTATCCGGTCTACCAGTGATGGG + Intronic
956536660 3:70284503-70284525 TGATCCAGTCTATCATTGATGGG - Intergenic
956689931 3:71866858-71866880 TTATCAAGTCTACCATTGATGGG - Intergenic
956846112 3:73184361-73184383 TTATCTAGTCTACTATTGATGGG + Intergenic
957108091 3:75917422-75917444 TCATCCGGTCTATCATTGATGGG + Intronic
957168283 3:76703748-76703770 TTGTCTAGTCTATCATTGATGGG + Intronic
957530208 3:81431284-81431306 TTATCTAGTCTATCATTGATGGG - Intergenic
957699569 3:83691032-83691054 TTATCTAGTCTATCATTGATGGG - Intergenic
957785278 3:84874490-84874512 TTATCTAGTCTATCATTGATGGG + Intergenic
957951356 3:87131400-87131422 TTATCTGGTCTACCATTTGTGGG + Intergenic
958161493 3:89821167-89821189 TTATCCCGTCTACCATTGATGGG - Intergenic
958545385 3:95541834-95541856 TAATCTAGTCTATCATTGATGGG + Intergenic
958606006 3:96359512-96359534 TTATCCAGTCTACCATTGATAGG - Intergenic
958709553 3:97700867-97700889 TGCACTGGTCTACCAGTGATGGG - Intronic
958817990 3:98938380-98938402 TTATCCAGTCTACCATTGATGGG - Intergenic
958871593 3:99565182-99565204 TTATCTAGTCAACCATTGATGGG + Intergenic
958874758 3:99603522-99603544 TTATCCAGTCTACCATTGATGGG + Intergenic
959339812 3:105114589-105114611 TTGTCTAGTCTATCATTGCTGGG - Intergenic
959394167 3:105815801-105815823 TTATCTAGTCTAACATTGATGGG - Intronic
959618902 3:108379075-108379097 TTATCCAGTCTACCATTGATGGG - Intergenic
959735548 3:109653973-109653995 TTATCTAGTCTATCATTGATGGG - Intergenic
959863190 3:111238386-111238408 TTATCCAGTCTACCATTGATGGG - Intronic
959960386 3:112291873-112291895 TTATCTAGTCTACCATTGATGGG - Intronic
960118395 3:113921296-113921318 TTATCCAGTCTACCATTGATGGG + Intronic
960430680 3:117565094-117565116 TTATCTGGTCTATCCTTGATAGG - Intergenic
960532165 3:118777438-118777460 TTATCCAGTCTACCATTGATGGG - Intergenic
960681376 3:120250624-120250646 TTATCCAGTCTACCATTGATGGG - Intronic
960867021 3:122212164-122212186 TTATCTAGTCTAACATTGATGGG - Intronic
961057533 3:123801813-123801835 TTATCTGCTCCACCATTGATAGG + Intronic
961082275 3:124036451-124036473 TTATCTAGTCTGCCATTGATGGG + Intergenic
961850574 3:129813414-129813436 TTATCCAGTCTACCATTGATGGG - Intronic
962124044 3:132596036-132596058 TTGTCCAGTCTATCATTGATGGG - Intronic
962160301 3:132992074-132992096 TTATCCAGTCTACCATTGATGGG + Intergenic
962459208 3:135593306-135593328 TTATCTAGTCTATCATTGATGGG - Intergenic
962507189 3:136059735-136059757 TTATCTGGTCTATCATTGATGGG - Intronic
962682898 3:137818552-137818574 TTGTTTAGTCTATCATTGATGGG - Intergenic
963279167 3:143365032-143365054 TTATCCTGTCTACCATTGATGGG - Intronic
963379524 3:144509842-144509864 TTATCCAGTCTACCATTGATGGG + Intergenic
963399945 3:144785674-144785696 TTATCTAGTCTATCATTGATGGG + Intergenic
963583003 3:147150501-147150523 TTATCTAGTCTATCATTGATGGG - Intergenic
963766110 3:149337615-149337637 TAATCCAGTCTACCATTGATGGG - Intergenic
963927305 3:150964661-150964683 TAATCTAGTCTATCATTGATGGG - Intronic
963980770 3:151534410-151534432 TTATCTGGTCTATCATTGATGGG - Intergenic
964110627 3:153083634-153083656 TTGTCCAGTCTATCATTGATGGG - Intergenic
964128901 3:153266085-153266107 TTATCTAGTCTATCATTGATGGG - Intergenic
964180384 3:153876316-153876338 TTGTTCAGTCTACCATTGATGGG + Intergenic
964238972 3:154569226-154569248 TTATCTAGTCTATCATTGATGGG - Intergenic
964685046 3:159386080-159386102 TTATCTAGTCTATCATTGATGGG + Intronic
964968405 3:162527432-162527454 TTATCTGTTCTATCATTGATGGG + Intergenic
964987371 3:162760690-162760712 TTATCCAGTCTACCATTGATGGG + Intergenic
965129008 3:164670467-164670489 TTATCTGGTCTATCTTTGATGGG - Intergenic
965159806 3:165118184-165118206 TTATCCAGTCTACCATTGATGGG + Intergenic
965171829 3:165275304-165275326 TTATCTAGTCTATCATTGATGGG + Intergenic
965295388 3:166938797-166938819 TTATCCAGTCTACCATTGATGGG + Intergenic
965310714 3:167124643-167124665 TTATCCAGTCTACCATTGATGGG - Intergenic
965343911 3:167523780-167523802 TTTTCTGGTCTATCATTGATGGG + Intronic
965351833 3:167621901-167621923 TGGTCTAGTCTCCCATGGATGGG - Intronic
966231155 3:177653670-177653692 TTATCTGGTCTATCATTGGTGGG + Intergenic
966276491 3:178178575-178178597 TTATCTAGTCTACCATTGATGGG - Intergenic
966357020 3:179091611-179091633 TTATCCAGTCTACCATTGATGGG - Intergenic
966490437 3:180522243-180522265 TTATCCAGTCTACCATTGATAGG - Intergenic
966632659 3:182095673-182095695 TTATCCAGTCTACCATTGATGGG + Intergenic
966670796 3:182523677-182523699 TTATCTAGTCTATCATTGATGGG + Intergenic
966693547 3:182765463-182765485 TAGTCTGGTCTTCAACTGATTGG + Intergenic
967122783 3:186398216-186398238 TTATCCGGTCTACCATTAATGGG + Intergenic
967344979 3:188445245-188445267 TTATCCAGTCTACCATTGATGGG - Intronic
967453057 3:189649251-189649273 GTGTCCAGTCTACCATTGATGGG - Intronic
967631434 3:191746735-191746757 TTATCTGGTCTGTCATTGATGGG + Intergenic
967660199 3:192098126-192098148 TCATCCAGTCTACCATTGATGGG - Intergenic
967701581 3:192598868-192598890 TTGTCCAGTCTATCATTGATGGG - Intronic
967782520 3:193455792-193455814 TTATCCAGTCTACCATTGATGGG - Intronic
968247707 3:197170146-197170168 TTATCCAGTCTACCATTGATGGG + Intronic
968418640 4:463512-463534 TTATCCAGTCTACCATTGATGGG - Intronic
969948571 4:10810098-10810120 TGGTCTATTCTACTATTCATGGG - Intergenic
970238074 4:13979153-13979175 TTATTTAGTCTACCATTGATGGG + Intergenic
970330803 4:14982018-14982040 TTCTTTAGTCTACCATTGATGGG - Intergenic
970703087 4:18766201-18766223 TTATCCGGTCTACCATTGATGGG + Intergenic
970939165 4:21611203-21611225 TTATCCAGTCTACCATTGATGGG + Intronic
971708078 4:30074397-30074419 TTATCCAGTCTACCATTGATGGG + Intergenic
971737906 4:30480997-30481019 TTATCCGGTCTACCATTGATAGG - Intergenic
971989689 4:33876124-33876146 TTATCTAGTCTACCACTGATGGG + Intergenic
972330525 4:38060110-38060132 TTATCTAGTCTATCATTGATGGG + Intronic
972984862 4:44750815-44750837 TTGTCTGGTCTATCATTGATGGG + Intergenic
973322320 4:48823146-48823168 TTATCCGGTCTATCATTGATGGG - Intronic
973590401 4:52434971-52434993 TTATCTAGTCTATCATTGATGGG + Intergenic
973600190 4:52534932-52534954 TTATCTAGTCTATCATTGATGGG - Intergenic
973694143 4:53473407-53473429 TTATCTAGTCTACCATTGATGGG - Intronic
973873974 4:55195728-55195750 TTATCTTGTCTATCATTGATGGG - Intergenic
974140821 4:57884413-57884435 TTATCCAGTCTACCATTGATGGG - Intergenic
974155615 4:58068471-58068493 TTATCCAGTCTACCATTGATGGG - Intergenic
974224893 4:59027971-59027993 TTATCTAGTCTATCATTGATAGG - Intergenic
974252325 4:59402805-59402827 TCATCTTGTCTACCATTGATGGG - Intergenic
974444631 4:61963648-61963670 TTTTCTGGTCCACCATTAATGGG + Intronic
974539045 4:63209347-63209369 TTATCTAGTCTACCATTAATAGG - Intergenic
974741100 4:66008939-66008961 TTATCTAGTCTATCATTGATGGG + Intergenic
974825163 4:67118926-67118948 TTATCTAGTCTATCATTGATGGG + Intergenic
974826141 4:67133537-67133559 TTATCAAGTCTACCATTGATGGG - Intergenic
974944165 4:68505955-68505977 TTATCCAGTCTACCATTGATGGG - Intergenic
974990696 4:69084851-69084873 TTGTCCAGTCTATCATTGATGGG + Intronic
975425586 4:74223183-74223205 TTATCTAGTCTACCATTAATGGG - Intronic
975524803 4:75337283-75337305 TAATCTGGTCTATCATTGATGGG - Intergenic
975589160 4:75983177-75983199 TTATCTAGTCTATCATTGATGGG + Intronic
975891964 4:79040451-79040473 TTATCCAGTCTACCATTGATGGG - Intergenic
975896612 4:79100048-79100070 TTATCTGGTCTACCATTGATGGG + Intergenic
975989897 4:80248008-80248030 TTGTCCAGTCTATCATTGATGGG - Intergenic
976015511 4:80548131-80548153 TTATCTGGTTCACCATTGATAGG - Intronic
976079433 4:81338365-81338387 TTTTCCAGTCTACCATTGATGGG + Intergenic
976438791 4:85049291-85049313 TTATCTCGTCTATCATTGATGGG - Intergenic
976448606 4:85161035-85161057 TTATCTAGTCTATCATTGATGGG + Intergenic
976545308 4:86328607-86328629 TTGTCCAGTCTATCATTGATGGG - Intronic
976981035 4:91229591-91229613 TTATCTAGTCTATCATTGATGGG - Intronic
977102103 4:92829688-92829710 TTGTCCAGTCTATCATTGATGGG - Intronic
977491347 4:97716454-97716476 TTATCTAGTCTATCATTGATGGG - Intronic
977512412 4:97978274-97978296 TTATCCAGTCTACCATTGATAGG - Intronic
977648538 4:99442333-99442355 TTATCCAGTCTACCATTGATGGG - Intergenic
977872476 4:102108320-102108342 TTATCCAGTCTACCATTGATGGG + Intergenic
977896164 4:102367953-102367975 TTATCCAGTCTACCATTGATGGG - Intronic
977956693 4:103035879-103035901 TTATCTAGTCTACCGTTGATGGG - Intronic
978317974 4:107461202-107461224 TTATCTAGTCTATCATTGATGGG - Intergenic
978538606 4:109790833-109790855 TTATCCAGTCTACCATTGATGGG + Intronic
979185504 4:117786529-117786551 TTATCCAGTCTACCATTGATGGG + Intergenic
979452549 4:120889930-120889952 TTATCTAGTCTACCATTGATGGG + Intronic
979605499 4:122634245-122634267 TTATCCAGTCTACCATTGATGGG + Intergenic
979626329 4:122849208-122849230 TTATCTAGTCTATCATTGATGGG - Intronic
979628051 4:122868505-122868527 TGATCCAGTCTATCATTGATGGG + Intronic
979817623 4:125129445-125129467 TTATCTAGTCTATCATTGATGGG + Intergenic
979835877 4:125366488-125366510 TAATCTGGTCTACCATTGATGGG + Intronic
979837598 4:125391274-125391296 TTGTCTAGTCTATCATTGATGGG - Intronic
979959219 4:126996252-126996274 TGTTTTGGTCTAACAGTGATTGG - Intergenic
979985768 4:127312543-127312565 TTATTTAGTCTACCATTGATGGG + Intergenic
980141438 4:128922406-128922428 TAATCCAGTCTACCATTGATGGG - Intronic
980239369 4:130153367-130153389 TTATCTAGTCTATCATTGATGGG + Intergenic
980257196 4:130397249-130397271 TTGTCCAGTCTACAATTGATGGG + Intergenic
980305377 4:131054085-131054107 TTATCTAGTCTATCATTGATGGG + Intergenic
980352162 4:131697841-131697863 TGGAGTGGTCAACCTTTGATGGG + Intergenic
980530037 4:134041330-134041352 TTATCCAGTCTACCATTGATGGG - Intergenic
980555643 4:134400336-134400358 TTATCAGATCTACCATTGATGGG + Intergenic
980959265 4:139458644-139458666 TTATCCTGTCTACCATTGATGGG + Intronic
981182797 4:141765338-141765360 TTATCTGGTCTACGATTAATGGG + Intergenic
981251170 4:142602965-142602987 TTGTCCAGTCTATCATTGATGGG - Intronic
981294376 4:143114475-143114497 TTATCTAGTCTATCATTGATGGG - Intergenic
981439170 4:144763016-144763038 TTATCTAGTCTACCATTTATAGG - Intergenic
981444811 4:144823374-144823396 TTATCCAGTCTACCATTGATGGG + Intergenic
981739875 4:147990547-147990569 TTATCTGGTCTACCACTCATGGG - Intronic
981866038 4:149420248-149420270 TTATCTAGTCTATCATTGATGGG - Intergenic
981894897 4:149786934-149786956 TTATCCAGTCTACCATTGATGGG - Intergenic
981959575 4:150520542-150520564 TTATCTGATCTACCATTGATGGG - Intronic
982195207 4:152904779-152904801 TTATCTGGTCTATCATTGATGGG + Intronic
982347998 4:154383092-154383114 TTGTCTAATCCACCATTGATGGG - Intronic
982601666 4:157459145-157459167 TTATCTAGTCTATCATTGATGGG - Intergenic
982961551 4:161844544-161844566 TTATCTAGTCTATCATTGATTGG - Intronic
982961973 4:161850774-161850796 TTATCTAGTCTATCATTGATGGG - Intronic
983166742 4:164487140-164487162 TTGTCTAGTCTATCATTGATGGG - Intergenic
983205928 4:164910130-164910152 TTATCTAGTCTATCATTGATTGG + Intergenic
983209312 4:164942605-164942627 TTGTCCAGTCTATCATTGATGGG - Intergenic
983275099 4:165607185-165607207 TTATCTGGTCTATCATTGATGGG + Intergenic
983522104 4:168719965-168719987 TTATCCAGTCTACCATTGATGGG + Intronic
983728400 4:170960791-170960813 TTATCCAGTCTACCATTGATGGG - Intergenic
983824207 4:172237101-172237123 TTATCCAGTCTACCATTGATTGG + Intronic
983838254 4:172420770-172420792 TTATCTAGTCTATCATTGATGGG - Intronic
984005927 4:174308232-174308254 TTATCTGCTCTATCATTGATGGG - Intronic
984212157 4:176863209-176863231 TTATCCAGTCTACCATTGATGGG - Intergenic
984585903 4:181563909-181563931 TGATCTTGTCTAACATTCATTGG + Intergenic
985352155 4:189075877-189075899 TTATCCAGTCTACCATTGATGGG - Intergenic
985953998 5:3248197-3248219 TTATCCAGTCTACCATTGATGGG + Intergenic
986005468 5:3664057-3664079 TTATCTCGTCTATCATTGATGGG + Intergenic
986045514 5:4033520-4033542 TTATCTAGTCTATCATTGATGGG + Intergenic
986055700 5:4135074-4135096 TTATCTAGTCTATCATTGATGGG - Intergenic
986161514 5:5233727-5233749 TTATCTGGTCTAACATTGATGGG + Intronic
986244405 5:5992449-5992471 TTATCCAGTCTACCATTGATGGG + Intergenic
986374572 5:7116889-7116911 TTATCCCGTCTACCATTGATGGG + Intergenic
986404190 5:7408985-7409007 TTATCCAGTCTACCATTGATGGG - Intronic
986467854 5:8044939-8044961 TTATCCAGTCTACCATTGATGGG - Intergenic
986520955 5:8617531-8617553 TTATCTAGTCTGCCATTGATGGG + Intergenic
986557049 5:9020954-9020976 TTATCTAGTCCACCATTGATAGG + Intergenic
986642175 5:9882981-9883003 TTATCTAGTCTATCATTGATGGG - Intergenic
986932481 5:12843341-12843363 TTATCTAGTCTATCATTGATGGG + Intergenic
986945173 5:13009395-13009417 TTATCTAATCTACCATTGATGGG - Intergenic
986973739 5:13370768-13370790 TTATCTAGTCTACCACTGATGGG - Intergenic
986975644 5:13390235-13390257 TTATCTAGTCTACTATTGATGGG - Intergenic
987173284 5:15281234-15281256 TTATCTAGTCTATCATTGATGGG - Intergenic
987459030 5:18184330-18184352 TTATCTGGTCTATGATTGATGGG + Intergenic
987820424 5:22959263-22959285 TAGTCTGCTCTACCACTTATGGG - Intergenic
987922185 5:24297243-24297265 TTATCTAGTCTAACATTGATTGG + Intergenic
988030342 5:25755779-25755801 TTATCCAGTCTACCATTGATGGG + Intergenic
988088399 5:26502607-26502629 TTATCCAGTCTACCATTGATGGG - Intergenic
988091972 5:26554758-26554780 TTATCTAGTCTACCATTGATGGG - Intergenic
988279897 5:29131387-29131409 TTATCTAGTCTACCATTGATGGG - Intergenic
988294168 5:29333262-29333284 TTATCTGATCTAGCATTGATGGG + Intergenic
988349137 5:30077851-30077873 TTATCTAGTCTATCATTGATGGG - Intergenic
988416592 5:30953724-30953746 TAATCTGGTCTATCATTGATGGG - Intergenic
988460263 5:31429350-31429372 TAGTCAGATCTACCATAGATGGG - Intronic
988619413 5:32807451-32807473 TTATCTAGTCTACCATTGATGGG + Intergenic
988667660 5:33347623-33347645 TGATCCAGTCCACCATTGATGGG - Intergenic
988715283 5:33820729-33820751 TTATCTAGTCTATCATTGATGGG - Intronic
988777860 5:34493203-34493225 TTATCTAGTCTATCATTGATGGG + Intergenic
988865471 5:35330069-35330091 TTATCCAGTCTACCATTGATAGG - Intergenic
988869945 5:35378291-35378313 TTATCCAGTCTACCATTGATGGG - Intergenic
988978863 5:36543656-36543678 TTATCCGGCCTACCATTGATGGG + Intergenic
989202260 5:38775328-38775350 TTGTCCAGTCTATCATTGATGGG - Intergenic
989340681 5:40371103-40371125 TTATCTAGTCTACTATTGATGGG - Intergenic
990024245 5:51165990-51166012 TTATCCAGTCTACCATTGATGGG - Intergenic
990295075 5:54393224-54393246 TTATCTGGTCTACCTTTGATGGG + Intergenic
990354054 5:54948277-54948299 TTATCCAGTCTACCATTGATGGG - Intergenic
990897175 5:60712129-60712151 TTATCTAGTCTATCATTGATGGG + Intergenic
990898189 5:60722427-60722449 TTATCCAGTCTACCATTGATAGG - Intergenic
991194235 5:63913103-63913125 TTGTCTAATCTACCATTGACAGG + Intergenic
991458979 5:66836549-66836571 TTATCCAGTCTACCATTGATGGG - Intronic
991504870 5:67314316-67314338 TTATCCAGTCTACCATTGATGGG - Intergenic
991626973 5:68612800-68612822 TGGTTTGCTCTACCAGTGAGTGG - Intergenic
992298939 5:75357597-75357619 TTATCCGGTCTATCATTGATGGG - Intronic
992347006 5:75889485-75889507 TTATCCAGTCTACCATTGATGGG + Intergenic
992378970 5:76218361-76218383 TTATCTAGTCTACCATTGATGGG - Intronic
993023143 5:82616139-82616161 TTATCCAGTCTACCATTGATGGG - Intergenic
993264013 5:85698322-85698344 TTATCCAGTCTACCATTGATGGG - Intergenic
993420209 5:87692098-87692120 TTGTCCAGTCTATCATTGATGGG + Intergenic
993459220 5:88162416-88162438 TTATCTAGTCTACCATTGATGGG + Intergenic
993566060 5:89477121-89477143 TTATCTAGTCTAACATTGATGGG + Intergenic
993577381 5:89619418-89619440 TGATCTAGTCTATCATTGATGGG + Intergenic
993642743 5:90425531-90425553 TTATCTAGTCTACCATCGATGGG - Intergenic
993751643 5:91676650-91676672 TTATCTAGTTTACCATTGATAGG + Intergenic
993759968 5:91782724-91782746 TGATGTAGTCTGCCATTGATTGG + Intergenic
993824173 5:92660731-92660753 TGCTATGGTCTCGCATTGATAGG + Intergenic
994119485 5:96097716-96097738 TTATCTAGTCTATCATTGATGGG + Intergenic
994225594 5:97248924-97248946 TTATCCAGTCTACCATTGATGGG - Intergenic
994315199 5:98325070-98325092 TTATCTAGTCTATCATTGATGGG + Intergenic
994598169 5:101866012-101866034 TTATCTAGTTTACCATTGATGGG - Intergenic
994603436 5:101937234-101937256 TTATCCAGTCTACCATTGATGGG + Intergenic
994645734 5:102466411-102466433 TTGTCCAGTCTATCATTGATGGG + Intronic
994802721 5:104399531-104399553 TGATCCAGTCTATCATTGATGGG - Intergenic
994864628 5:105251164-105251186 TTATCTAGTCTACCATTGATAGG - Intergenic
995138085 5:108702075-108702097 TTGTCCAGTCTATCATTGATGGG + Intergenic
995254070 5:110025991-110026013 TCATCTAGTCTACCATTGATGGG - Intergenic
995322893 5:110857185-110857207 TTATCTAGTCTATCATTGATGGG - Intergenic
995578481 5:113568759-113568781 TTATCTAGCCTACCATTGATGGG + Intronic
995603826 5:113828905-113828927 TTATCTAGTCTACCACTGATGGG + Intergenic
995672218 5:114618932-114618954 TTATCTTGTCTACCATTGATGGG - Intergenic
995718003 5:115099403-115099425 TTATCCAGTCTACCATTGATGGG + Intergenic
996025838 5:118645114-118645136 TTATCAGGTCTACCGTTGATGGG - Intergenic
996180558 5:120414125-120414147 TTATCCAGTCTACCATTGATGGG - Intergenic
996427403 5:123329734-123329756 TAATCCGGTCTATCATTGATGGG + Intergenic
996469382 5:123842497-123842519 TTATCCAGTCTACCATTGATGGG - Intergenic
996649646 5:125858805-125858827 TTATCTAGTCTATCATTGATGGG + Intergenic
996681475 5:126232067-126232089 TTATCCAGTCTACCATTGATGGG - Intergenic
996784323 5:127222320-127222342 TTGTCCGGTCTGTCATTGATGGG - Intergenic
996850474 5:127946031-127946053 TTATCCAGTCTACCATTGATGGG + Intergenic
996868539 5:128158588-128158610 TTATCCAGTCTACCATTGATGGG + Intronic
996965242 5:129300144-129300166 TTATCTAGTCTATCATTGATGGG + Intergenic
996997072 5:129710357-129710379 TGATCCAGTCTATCATTGATGGG + Intronic
997038442 5:130221782-130221804 TTATCTAGTCTATCATTGATGGG + Intergenic
997053133 5:130406824-130406846 TTATCCAGTCTACCATTGATGGG + Intergenic
997183614 5:131859180-131859202 TTATCCAGTCTACCATTGATGGG - Intronic
997604620 5:135165494-135165516 TTGTCCAGTCTATCATTGATGGG + Intronic
997608850 5:135196287-135196309 TTCTTTAGTCTACCATTGATGGG + Intronic
998601361 5:143588568-143588590 TTCTCCAGTCTACCATTGATGGG - Intergenic
999071034 5:148744353-148744375 TTATCTAGTCTACCGTTGATGGG - Intergenic
999798107 5:155006846-155006868 TTATCTAGTCTACCATTGATGGG + Intergenic
999984513 5:156990493-156990515 TGATCCAGTCTATCATTGATGGG - Intergenic
1000011182 5:157234560-157234582 TTGTCCAGTCTATCATTGATGGG + Intronic
1000155550 5:158547883-158547905 TTATCTGGTCTATCATTGATGGG + Intergenic
1000161866 5:158605566-158605588 TTATCCAGTCTACCATTGATGGG + Intergenic
1000406978 5:160898751-160898773 TTATCTGGTCTGTCATTGATGGG - Intergenic
1000522005 5:162306993-162307015 TTATCTAGTCTATCATTGATGGG - Intergenic
1000547336 5:162619580-162619602 TCCTCCAGTCTACCATTGATGGG + Intergenic
1000997855 5:167976924-167976946 TTATCTAGTCTACCATTGATGGG - Intronic
1001186003 5:169573466-169573488 TGGTTTGGTCTTCCACTGTTTGG - Intergenic
1001290608 5:170456065-170456087 TTGTCCAGTCTATCATTGATGGG - Intronic
1001369110 5:171178405-171178427 TTATCCGGTCTATCATTGATGGG + Intronic
1001760010 5:174199645-174199667 TTATCCGGTCCACCATTGATGGG + Intronic
1001831422 5:174792506-174792528 TTATCCAGTCTACCATTGATAGG + Intergenic
1003200169 6:3952145-3952167 TTATCCAGTCTACCATTGATGGG + Intergenic
1003436840 6:6098068-6098090 TTATCTAGTCTACCATTGATTGG + Intergenic
1003443370 6:6163699-6163721 GTGTCCAGTCTACCATTGATGGG + Intronic
1003844339 6:10157140-10157162 TTATCTAGTCTATCATTGATGGG + Intronic
1004091766 6:12510143-12510165 TTATCCAGTCTACCATTGATAGG + Intergenic
1004470585 6:15925506-15925528 TTATCTAGTCTACCATTGATGGG - Intergenic
1004805300 6:19197691-19197713 TTATCAAGTCTACCATTGATGGG + Intergenic
1004885102 6:20043591-20043613 TTATCCAGTCTACCATTGATAGG + Intergenic
1004975747 6:20964415-20964437 TGATCTAGTCTATCACTGATGGG - Intronic
1004981537 6:21030081-21030103 TTGTCCAGTCTATCATTGATGGG - Intronic
1005058179 6:21750250-21750272 TATTCTGTTCTAGCATTGATAGG + Intergenic
1005917819 6:30369421-30369443 TTATCTAGTCTACCATTGGTAGG - Intergenic
1006053395 6:31361388-31361410 TTATCCAGTCTACCATTGATGGG - Intergenic
1006250815 6:32782157-32782179 TTATCTAGTCTATCATTGATGGG + Intergenic
1006251329 6:32788875-32788897 TTATTTAGTCTACCATTGATGGG - Intergenic
1006557841 6:34884170-34884192 TTATCCAGTCTACCATTGATGGG - Intronic
1007024877 6:38560968-38560990 TTATCCAGTCTACCATTGATGGG + Intronic
1007288597 6:40766614-40766636 TTGTCCAGTCTACCACTGATGGG + Intergenic
1008066472 6:47054550-47054572 TAATCTAGTCTATCATTGATGGG + Intergenic
1008095264 6:47333585-47333607 TAGTCCAGTCTAACATTGATGGG - Intergenic
1008708690 6:54196570-54196592 TTATCTGGTCTATCATTGATGGG + Intronic
1009317133 6:62233871-62233893 TCATCCAGTCTACCATTGATGGG + Intronic
1009512817 6:64574032-64574054 TTGTCCAGTCTATCATTGATGGG - Intronic
1009554038 6:65139187-65139209 TTATCTAGTCTACCATTGATGGG - Intronic
1009646553 6:66410748-66410770 TTATGTGGTCTACCACTGATGGG - Intergenic
1010595103 6:77753857-77753879 TTGTCCAGTCTATCATTGATGGG - Intronic
1010616693 6:78021537-78021559 TTATCCAGTCTACCATTGATGGG - Intergenic
1010818355 6:80386318-80386340 TTATCCAGTCTACCATTGATGGG - Intergenic
1010820853 6:80413684-80413706 TTATCCAGTCTACCATTGATGGG + Intergenic
1010849449 6:80753776-80753798 TTTTCCAGTCTACCATTGATGGG + Intergenic
1010946161 6:81975820-81975842 TTATCTAGTCTATCATTGATGGG - Intergenic
1011919558 6:92555683-92555705 TGTTCTGGTCTCCCTTTGTTGGG + Intergenic
1012236217 6:96819275-96819297 TTATCTAGTCTATCATTGATGGG - Intronic
1012284595 6:97373676-97373698 TTATCCAGTCTACCATTGATGGG + Intergenic
1012577127 6:100816513-100816535 TTGTCCAGTCTACCAATGATGGG - Intronic
1012666084 6:101971981-101972003 TTATCTGTTCCACCATTGATTGG + Intronic
1012991831 6:105934075-105934097 TTCTCCAGTCTACCATTGATGGG + Intergenic
1013334554 6:109142217-109142239 TTATCTAGTCTATCATTGATGGG - Intronic
1013389976 6:109675360-109675382 TTATCTAGTCTACCACTGATGGG + Intronic
1013390028 6:109676850-109676872 TTATCTAGTCTACCACTGATGGG - Intronic
1013860222 6:114626472-114626494 TTATCTAGTCTATCATTGATGGG + Intergenic
1014063080 6:117095653-117095675 TTATCTAGTCTATCATTGATGGG + Intergenic
1014113880 6:117651284-117651306 TTATCTAGTCTATCATTGATGGG - Intergenic
1014128599 6:117805389-117805411 TTATCTATTCTACCATTGATGGG + Intergenic
1014133509 6:117862370-117862392 TTATCCAGTCTACCATTGATGGG - Intergenic
1014481368 6:121941652-121941674 TTATCCAGTCTACCATTGATGGG + Intergenic
1014683520 6:124465238-124465260 TTATCCAGTCTACCATTGATCGG - Intronic
1014844604 6:126259512-126259534 TTATCCAGTCTACCATTGATGGG + Intergenic
1015192026 6:130482167-130482189 TTATCCAGTCTACCATTGATAGG - Intergenic
1015263025 6:131260189-131260211 TTATCTAGTCTATCATTGATGGG + Intronic
1015393570 6:132710757-132710779 TTATCCAGTCTACCATTGATGGG + Intronic
1015906179 6:138119119-138119141 TTATCCAGTCTACCATTGATGGG + Intergenic
1016054054 6:139559951-139559973 TTATCTAGTCTACTATTGATGGG + Intergenic
1016168234 6:140974798-140974820 TTATCTAGTCTATCATTGATGGG - Intergenic
1016265470 6:142227921-142227943 TGATCCAGTCTATCATTGATGGG + Intergenic
1016368479 6:143344135-143344157 TTATCTAGTCTACTATTGATGGG + Intergenic
1016470132 6:144366634-144366656 TTATCCAGTCTACCATTGATGGG + Intronic
1016554211 6:145316960-145316982 TTATCCAGTCTACCATTGATGGG + Intergenic
1016567730 6:145475222-145475244 TTATCTAGTCTATCATTGATGGG - Intergenic
1016604816 6:145908149-145908171 TTATCTAGTCTATCATTGATGGG + Intronic
1016768216 6:147819083-147819105 TTATCCAGTCTACCATTGATTGG - Intergenic
1017026757 6:150187680-150187702 TTATCTAGTCTATCATTGATGGG + Intronic
1017745103 6:157439765-157439787 TTATCTAGTCTATCATTGATGGG - Intronic
1019014398 6:168869323-168869345 TTATCTAGTCTATCATTGATGGG - Intergenic
1019792051 7:3021389-3021411 TTATCCGGTCTATCATTGATGGG - Intronic
1019967179 7:4509309-4509331 TTATCTAGTCTACCACTGATGGG - Intergenic
1020491384 7:8788518-8788540 TTTTCTAGTCTACCATTGGTGGG + Intergenic
1020546175 7:9534328-9534350 TAATCCAGTCTACCATTGATGGG + Intergenic
1020571093 7:9862769-9862791 TTATCTAGTCTACCATTGACAGG - Intergenic
1020584806 7:10053080-10053102 TTATCCGGTCTATCATTGATGGG - Intergenic
1020817022 7:12918058-12918080 TCATCTAGTCTACCATTGATGGG + Intergenic
1020985978 7:15134687-15134709 TTATCTGGTCTACCTTTGATGGG + Intergenic
1021228593 7:18058430-18058452 TTATCCGGTCTATCATTGATGGG - Intergenic
1021464543 7:20927315-20927337 TTATCTAGTCTATCATTGATGGG - Intergenic
1022370718 7:29768906-29768928 TTATCCAGTCTACCATTGATGGG - Intergenic
1022688810 7:32624847-32624869 TTATCTGGTCTATCATTGATGGG - Intergenic
1022737344 7:33088656-33088678 TTATCCAGTCTACCATTGATGGG + Intergenic
1022847948 7:34229934-34229956 TAATCCGGTCTATCATTGATGGG + Intergenic
1023051334 7:36254512-36254534 TTGTCCAGTCTATCATTGATGGG + Intronic
1023066551 7:36383419-36383441 TTATCTAGTCTATCATTGATGGG - Intronic
1023167379 7:37356187-37356209 TTATCTAGTCTATCATTGATGGG + Intronic
1023224451 7:37954348-37954370 TTATCTAGTCTAACATTGATGGG - Intronic
1023367658 7:39479922-39479944 TTATCTAGTCTATCATTGATGGG - Intronic
1023457164 7:40352664-40352686 TTATCCAGTCTACCATTGATGGG + Intronic
1024183597 7:46924521-46924543 TTATCCAGTCTACCATTGATGGG + Intergenic
1024332225 7:48167431-48167453 TTTTCTGTTCCACCATTGATGGG - Intergenic
1024933454 7:54688879-54688901 TGATCCAGTCTATCATTGATGGG - Intergenic
1024944354 7:54793969-54793991 TTATCCAGTCTACCATTGATGGG - Intergenic
1025018011 7:55456554-55456576 TTATCCAGTCTACCATTGATGGG - Intronic
1025615193 7:63112370-63112392 TTATCCAGTCTACCATTGATGGG + Intergenic
1025715137 7:63949213-63949235 TTATCCGGTCTATCATTGATGGG - Intergenic
1025779365 7:64585980-64586002 TTATCCAGTCTACCATTGATAGG + Intergenic
1025842027 7:65159098-65159120 TTGTCCAGTCTATCATTGATGGG + Intergenic
1025881021 7:65536884-65536906 TTGTCCAGTCTATCATTGATGGG - Intergenic
1025892417 7:65665731-65665753 TTGTCCAGTCTATCATTGATGGG + Intergenic
1025969541 7:66309411-66309433 TTGTCTGGTCTAACATTCTTAGG + Intronic
1026140599 7:67702875-67702897 TTATCCAGTCTACCATTGATGGG - Intergenic
1026296195 7:69054343-69054365 TTATCAAGTCTACCATTGATGGG + Intergenic
1026334851 7:69385148-69385170 TTATCTAGTCTATCATTGATGGG - Intergenic
1026401526 7:70019017-70019039 TTATCCAGTCTACCATTGATGGG - Intronic
1026422130 7:70250621-70250643 TTGTCCAGTCTACCACTGATGGG - Intronic
1026486660 7:70827860-70827882 TTATCCAGTCTACCATTGATGGG + Intergenic
1026492725 7:70876604-70876626 TCATCCAGTCTACCATTGATGGG + Intergenic
1026618545 7:71929522-71929544 TTATCCAGTCTACCATTGATGGG + Intronic
1027346169 7:77261831-77261853 TTATCTGGTCTACCATTGATGGG + Intronic
1027879284 7:83812809-83812831 TTGTCCAGTCTAGCATTGATGGG + Intergenic
1028008513 7:85610640-85610662 TTATCTAGTCTATCATTGATGGG - Intergenic
1028080806 7:86572928-86572950 TTATCTGGTCTATCATTGATGGG - Intergenic
1028146099 7:87321805-87321827 TTATCCGGTCTATCATTGATGGG - Intergenic
1028152426 7:87389379-87389401 TTATCTAGTCTATCATTGATGGG - Intronic
1028330155 7:89580186-89580208 TTATCTAATCTACCATTGATAGG - Intergenic
1028337750 7:89678608-89678630 TTGTCCCGTCTACCACTGATGGG - Intergenic
1028644668 7:93082130-93082152 TTATCTAGTCTATCATTGATGGG - Intergenic
1029145916 7:98445897-98445919 TTATCCAGTCTACCATTGATGGG - Intergenic
1029250185 7:99230616-99230638 TTGTCCAGTCTACCACTGATGGG + Intergenic
1029849696 7:103448748-103448770 TTATCCGGTCTATCATTGATGGG + Intergenic
1029907667 7:104107768-104107790 TTATCCAGTCTACCATTGATGGG + Intergenic
1029956003 7:104640506-104640528 TTATCCGGTCTATCATTGATGGG + Intronic
1030549177 7:110936805-110936827 TTATCTAGTCTATCATTGATAGG - Intronic
1030718901 7:112845839-112845861 TTATCCAGTCTACCATTGATGGG - Intronic
1030806468 7:113926082-113926104 TTATCCAGTCTACCATTGATGGG + Intronic
1030969108 7:116032437-116032459 TTATCCAGTCTACCATTGATGGG - Intronic
1030986558 7:116248203-116248225 TTATCCAGTCTACCATTGATGGG + Intronic
1031249713 7:119364090-119364112 TTGTCCAGTCTATCATTGATTGG + Intergenic
1031258242 7:119483610-119483632 TTATCTGGTATACCATTGATGGG + Intergenic
1031312263 7:120213231-120213253 TTATCTGTTCTACCATTGATGGG - Intergenic
1031445607 7:121849814-121849836 TTATCTGGTCTATCACTGATGGG - Intergenic
1031613233 7:123851627-123851649 TGATCCAGTCTATCATTGATGGG + Intronic
1031623573 7:123966524-123966546 TTATCTAGTCTATCATTGATAGG - Intronic
1031745173 7:125487275-125487297 TTATCCAGTCTACCATTGATGGG - Intergenic
1032313609 7:130813062-130813084 TAATCTAGTCTATCATTGATGGG + Intergenic
1032499534 7:132390173-132390195 TTGTCCAGTCTATCATTGATGGG - Intronic
1032659220 7:133964714-133964736 TTATCTAGTCTATCATTGATGGG + Intronic
1032861319 7:135882533-135882555 TTATCCAGTCTACCATTGATGGG - Intergenic
1033433486 7:141310905-141310927 TTATCTGGTCTATGATTGATGGG - Intronic
1033475611 7:141689208-141689230 TTATCCGGTCTACCATTGATAGG - Intronic
1033526074 7:142215057-142215079 TTATCTGGTCTAACACTGATGGG - Intronic
1033592786 7:142827292-142827314 TGATCCAATCTACCATTGATGGG - Intergenic
1034370194 7:150588418-150588440 TTATCCAGTCTACCATTGATGGG + Intergenic
1034540056 7:151752157-151752179 TTATCTGGTCTGTCATTGATGGG - Intronic
1034779334 7:153863319-153863341 TTATCCGGTCTATCATTGATGGG + Intergenic
1035453517 7:158994823-158994845 TTATCTGGTCTGCCACTGATAGG - Intergenic
1035539729 8:423678-423700 TTATCCAGTCTACCATTGATGGG + Intronic
1035906003 8:3510986-3511008 TTGTTTGGTCTATCATTGATGGG - Intronic
1036080152 8:5546586-5546608 TTATCTAGTCTATCATTGATGGG - Intergenic
1036103605 8:5815266-5815288 TTATCCAGTCTACCATTGATGGG - Intergenic
1038048539 8:23788055-23788077 TTATCCAGTCTACCATTGATGGG - Intergenic
1038167146 8:25096886-25096908 TTATCTGGTCTATCATTGACAGG - Intergenic
1038308756 8:26428828-26428850 TTATCCAGTCTACCATTGATGGG - Intronic
1038830628 8:31055104-31055126 TTATCTAGTCTATCATTGATGGG + Intronic
1038859427 8:31370547-31370569 TTATCCAGTCTACCATTGATAGG + Intergenic
1038984635 8:32794964-32794986 TTATCTGGTCTATCATTGATGGG + Intergenic
1039028192 8:33281185-33281207 TTATCTGGTCTAACATTGATGGG - Intergenic
1039073725 8:33669973-33669995 TTATCCAGTCTACCATTGATGGG - Intergenic
1039085987 8:33780343-33780365 TTATCCAGTCTACCATTGATGGG + Intergenic
1039697371 8:39927088-39927110 TTGTCCCATCTACCATTGATGGG + Intronic
1039776266 8:40740029-40740051 TTATCCAGTCTACCATTGATGGG + Intronic
1040350861 8:46566119-46566141 TTATCTAGTCTACCACTGATGGG - Intergenic
1040751353 8:50712888-50712910 TGATCCAGTCTATCATTGATGGG + Intronic
1040911618 8:52524826-52524848 TTATCCAGTCTACCATTGATAGG + Intergenic
1040963416 8:53059839-53059861 TTATCCAGTCTACCATTGATGGG - Intergenic
1041353840 8:56978644-56978666 TTACCTGGTCTATCATTGATGGG - Intronic
1041639493 8:60181275-60181297 TTATCCAGTCTACCATTGATGGG - Intergenic
1041738621 8:61136439-61136461 TTATCCGGTCTATCATTGATGGG - Intronic
1042339446 8:67663758-67663780 TTGTCCAGTCTATCATTGATGGG + Intronic
1042473599 8:69219747-69219769 TTATCTAGTCTATCATTGATGGG - Intergenic
1042628997 8:70795359-70795381 TTATTTAGTCTACCATTGATGGG + Intergenic
1042662223 8:71167140-71167162 TTATCTAGTCTATCATTGATGGG + Intergenic
1042690544 8:71493149-71493171 TTATCTAGTCTACCATTGATTGG + Intronic
1042806907 8:72780607-72780629 TTATCTAGTCTATCATTGATGGG + Intronic
1042854075 8:73247327-73247349 TTATCCAGTCTACCATTGATGGG + Intronic
1042981679 8:74536495-74536517 TTATCTAGTCTACCATTTATGGG + Intergenic
1043236147 8:77869628-77869650 TGTTTTAGTCTAGCATTGATGGG - Intergenic
1043325037 8:79039676-79039698 TTATCTGATCTATCATTGATGGG - Intergenic
1043337064 8:79189229-79189251 TTATCCAGTCTACCATTGATGGG - Intergenic
1043732205 8:83696395-83696417 TTATCCAGTCTACCATTGATGGG + Intergenic
1044307574 8:90655803-90655825 TTATCAAGTCTACCATTGATGGG - Intronic
1044311968 8:90704096-90704118 TTATCCAGTCTACCATTGATGGG + Intronic
1044452472 8:92353607-92353629 TTATCTAGTCTATCATTGATGGG + Intergenic
1044596424 8:93963113-93963135 TTATCTAGTCCACCATTGATGGG + Intergenic
1044759255 8:95500121-95500143 TTATCCAGTCTACCATTGATGGG - Intergenic
1045166368 8:99610346-99610368 TTATCAGGTCTATCATTGATGGG - Intronic
1045691725 8:104766228-104766250 TCATCCAGTCTACCATTGATGGG - Intronic
1045874259 8:106960975-106960997 TTATCCAGTCTACCATTGATGGG - Intergenic
1046421315 8:113986913-113986935 TCATCCGATCTACCATTGATGGG - Intergenic
1046688699 8:117257447-117257469 TGATCTAATCCACCATTGATGGG - Intergenic
1046814629 8:118570594-118570616 TTATCCAGTCTACCATTGATGGG + Intronic
1046895631 8:119469257-119469279 TTATCCAGTCTACCATTGATGGG - Intergenic
1047051536 8:121118298-121118320 TTATCCAGTCTACCATTGATGGG - Intergenic
1047573382 8:126127005-126127027 TTGTCCAGTCTATCATTGATGGG - Intergenic
1048071617 8:131027567-131027589 TGGTTTAGTCTTCCATTGCTGGG - Intronic
1048088408 8:131209982-131210004 TTATCCGGTCTCCCATTGATGGG + Intergenic
1048101323 8:131355120-131355142 TTATCCAGTCTACCATTGATGGG + Intergenic
1048153185 8:131914335-131914357 TTGTTTGGTCTTCCAGTGATGGG + Intronic
1048761412 8:137799499-137799521 TTATCCAGTCTACCATTGATGGG + Intergenic
1048784766 8:138038956-138038978 TTATCTAGTCTATCATTGATGGG - Intergenic
1049506389 8:143002033-143002055 TTATCCAGTCTACCATTGATGGG + Intergenic
1050003599 9:1104025-1104047 TTATCCAGTCTACCATTGATGGG + Intergenic
1050181433 9:2927135-2927157 TTATCTAGTCTATCATTGATGGG - Intergenic
1050238408 9:3608022-3608044 TCATCCAGTCTACCATTGATGGG + Intergenic
1050894405 9:10868849-10868871 TTATCTAGTCTACCATTGATGGG - Intergenic
1050896965 9:10895629-10895651 TGTTCTTGTCTACCATTAACTGG - Intergenic
1050982805 9:12041579-12041601 TTATCTAGTCTATCATTGATGGG - Intergenic
1051656772 9:19389653-19389675 TTATCCAGTCTACCATTGATGGG - Intergenic
1051706532 9:19886808-19886830 TCATCTAGTCTATCATTGATTGG - Intergenic
1051792977 9:20829022-20829044 TGATCTGGTCTATCATTGATGGG + Intronic
1051796355 9:20875702-20875724 TGGTATCGTCTACCATTTCTTGG - Intronic
1051914649 9:22193653-22193675 TTATCAAGTCTACCATTGATGGG + Intergenic
1051982816 9:23045404-23045426 TTACCTAGTCTACCATTGATAGG - Intergenic
1052146626 9:25058530-25058552 TTACCTGGTCTATCATTGATGGG + Intergenic
1052163702 9:25295045-25295067 TTATCTAGTCTATCATTGATGGG + Intergenic
1052180783 9:25524736-25524758 TTGTTTGGTCTATCATTGATGGG + Intergenic
1052360772 9:27554271-27554293 TTATCCAGTCTACCATTGATAGG - Intronic
1052636703 9:31115799-31115821 TCATCTAGTCTATCATTGATGGG - Intergenic
1052694554 9:31859585-31859607 TTATCTGGTCCACCATTGATGGG - Intergenic
1052767427 9:32656134-32656156 TTATCTTGTCTATCATTGATGGG - Intergenic
1052793098 9:32895881-32895903 TTATCTAGTCTACCATTGATGGG + Intergenic
1053040765 9:34869139-34869161 TTATCCAGTCTACCATTGATGGG + Intergenic
1053115111 9:35493369-35493391 TTATCTGGTCTGTCATTGATGGG + Intronic
1053780548 9:41601873-41601895 TGGAGTGGTCAACCTTTGATGGG - Intergenic
1054168491 9:61812030-61812052 TGGAGTGGTCAACCTTTGATGGG - Intergenic
1054669038 9:67768788-67768810 TGGAGTGGTCAACCTTTGATGGG + Intergenic
1054757252 9:68971379-68971401 TTATCTAGTCTATCATTGATGGG + Intronic
1054793524 9:69277578-69277600 TTATCCAGTCTACCATTGATGGG + Intergenic
1054991902 9:71337688-71337710 TTATCCAGTCTACCATTGATGGG - Intronic
1055125180 9:72711152-72711174 TTATCTAGTCTATCATTGATGGG + Intronic
1055133414 9:72801781-72801803 TTGGCTGGGCTACCATTGTTTGG + Intronic
1055657037 9:78461316-78461338 TTATCTAGTCTATCATTGATGGG - Intergenic
1055881118 9:81005009-81005031 TTATCTAGTCTATCATTGATAGG - Intergenic
1056085388 9:83143909-83143931 TTATCCAGTCTACCATTGATGGG - Intergenic
1056089619 9:83192311-83192333 TTATCCAGTCTACCATTGATGGG - Intergenic
1056150160 9:83778301-83778323 TTATCCAGTCTACCATTGATGGG - Intronic
1056192201 9:84195339-84195361 TTATATAGTCTACCATTGATGGG - Intergenic
1057002339 9:91522851-91522873 TGCTCAGGTCTTCAATTGATTGG + Intergenic
1057284146 9:93735450-93735472 TTATCCAGTCTACCATTGATGGG - Intergenic
1058781717 9:108343674-108343696 TTATCTGATCCACCATTGATGGG - Intergenic
1059028621 9:110665263-110665285 TTATCTAGTCTATCATTGATTGG + Intergenic
1059371127 9:113837218-113837240 TTATCTAGTCTATCATTGATGGG + Intergenic
1060030108 9:120207299-120207321 TTATCTAGGCTACCATTGATGGG + Intergenic
1060486931 9:124053788-124053810 TGATCCGGTCTCCTATTGATGGG + Intergenic
1060882539 9:127128232-127128254 TTATCTAGTCTATCATTGATGGG + Intronic
1185674788 X:1840440-1840462 TTATCCGGTCTATCATTGATGGG + Intergenic
1185693699 X:2178082-2178104 TTATCCAGTCTACCATTGATGGG - Intergenic
1185741287 X:2534786-2534808 TCATCTAGTCTATCATTGATTGG - Intergenic
1185775517 X:2800029-2800051 TTATCCAGTCTACCATTGATGGG + Intronic
1185819989 X:3193635-3193657 TTATCCAGTCTACCATTGATGGG - Intergenic
1185820061 X:3194235-3194257 TTATCCAGTCTACCATTGATGGG + Intergenic
1185824411 X:3236073-3236095 TTATCCAGTCTACCATTGATGGG + Intergenic
1186068988 X:5797096-5797118 TTATCCAGTCTACCATTGATGGG - Intergenic
1186373267 X:8968401-8968423 TTATCTAGTCTACCATTGGTGGG - Intergenic
1186572811 X:10734143-10734165 TTGTCCAATCTACCATTGATGGG - Intronic
1186609255 X:11123240-11123262 TTATCTAGTCTATCATTGATGGG - Intergenic
1186685102 X:11917496-11917518 TTGTCCAGTCCACCATTGATGGG - Intergenic
1186703293 X:12115060-12115082 TGGCCTGGTCTACCCCTGTTAGG - Intergenic
1186832930 X:13408692-13408714 TTGTCCAGTCTATCATTGATGGG - Intergenic
1187845887 X:23536809-23536831 TTGTCCAGTCTACAATTGATGGG - Intergenic
1187943444 X:24403359-24403381 TTGTCCAGTCTATCATTGATGGG + Intergenic
1187945278 X:24420322-24420344 TTATCCAGTCTACCATTGATGGG + Intergenic
1188053960 X:25520525-25520547 TTATCTAGTCTATCATTGATGGG - Intergenic
1188145545 X:26608040-26608062 TTATCCAGTCTACCATTGATGGG - Intergenic
1188172599 X:26946233-26946255 TCATCTGGTCTACCGCTGATGGG + Intergenic
1188204221 X:27332614-27332636 TTATCCAGTCTACCATTGATGGG - Intergenic
1188295895 X:28447879-28447901 TTATCCAGTCTACCATTGATGGG - Intergenic
1188345019 X:29053263-29053285 TTATCCAGTCTACCATTGATGGG + Intronic
1188356863 X:29202614-29202636 TTATCCAGTCTACCATTGATGGG - Intronic
1188360332 X:29245160-29245182 TTATCTGGTCTATCATTGATGGG + Intronic
1188573498 X:31617829-31617851 ATATCTGATCTACCATTGATGGG - Intronic
1188681617 X:33015268-33015290 TGGTCCAGTCTATCATTGACGGG - Intronic
1188738231 X:33744315-33744337 TTTTCTAGTCTAACATTGATGGG - Intergenic
1188757137 X:33975826-33975848 TTATATAGTCTACCATTGATGGG - Intergenic
1188759155 X:34004120-34004142 TTCTTTAGTCTACCATTGATGGG - Intergenic
1188784129 X:34323321-34323343 TCATCCAGTCTACCATTGATGGG - Intergenic
1188826288 X:34839442-34839464 TTATCCTGTCTACCATTGATGGG + Intergenic
1188880383 X:35485081-35485103 TTGTCCAGGCTACCATTGATGGG - Intergenic
1188952856 X:36397683-36397705 TTATCCAGTCTACCATTGATGGG + Intergenic
1188992067 X:36833671-36833693 TTATCTAGTCTACCATTGATGGG - Intergenic
1189050153 X:37636199-37636221 TTATCCAGTCTACCATTGATGGG + Intronic
1189211014 X:39282594-39282616 TTATCCAGTCTACCATTGATGGG - Intergenic
1189362644 X:40364613-40364635 TTATCTAGTCCACCATTGATGGG + Intergenic
1189898281 X:45679230-45679252 TTATCCAGTCTACCATTGATAGG - Intergenic
1189938903 X:46100035-46100057 TTGTCTGCTCTATCATTGATGGG + Intergenic
1189979261 X:46492746-46492768 TTATCTGGTCTATCATTGATGGG - Intronic
1190133296 X:47770784-47770806 TTATCCAGTCTACCATTGATGGG - Intergenic
1190143280 X:47866858-47866880 TTATCTAGTCTATCATTGATGGG - Intronic
1190159252 X:48018319-48018341 TTGTCCAGACTACCATTGATGGG - Intronic
1190174965 X:48140548-48140570 TTGTCCAGACTACCATTGATGGG - Intergenic
1190551061 X:51581412-51581434 TTATCTGGTCTATCACTGATGGG - Intergenic
1190557719 X:51653162-51653184 TTGTTTGGTCCAACATTGATGGG + Intergenic
1190809636 X:53870749-53870771 TTATCCAGTCTACCATTGATGGG + Intergenic
1190880622 X:54489938-54489960 TTGTCCAGTCTACTATTGATGGG - Intronic
1190926258 X:54908123-54908145 TTATCCGGTCTATCATTGATAGG - Intergenic
1190958100 X:55217146-55217168 TTATCCAGTCTACCATTGATGGG + Intronic
1191043456 X:56110169-56110191 TTATCTGGTCTATCATTGATGGG + Intergenic
1191047621 X:56156040-56156062 TTGTCCAATCTACCATTGATGGG + Intergenic
1191096903 X:56682595-56682617 TTATCCAGTCTACCATTGATGGG - Intergenic
1191147721 X:57185951-57185973 TTATCTAGTCTATCATTGATGGG + Intergenic
1191600485 X:63000063-63000085 TTATCTAGTCTACCATTGATGGG + Intergenic
1191629539 X:63307165-63307187 TTATCTGGTCTACAATAGATGGG - Intergenic
1191703246 X:64065386-64065408 TTATCTAGTCTATCATTGATGGG + Intergenic
1191906267 X:66094034-66094056 TTATCTGGTTTACCGTTGATGGG - Intergenic
1192074059 X:67972727-67972749 TTATCTGGTCTATCACTGATGGG - Intergenic
1192418746 X:71009407-71009429 TTATCCAGTCTACCATTGATGGG + Intergenic
1192450310 X:71240682-71240704 GGGGCTGGTCTCCCAGTGATGGG - Exonic
1192508222 X:71703822-71703844 TTATCCAGTCTACCATTGATGGG + Intergenic
1192512452 X:71731076-71731098 TTATCCAGTCTACCATTGATGGG - Intergenic
1192514245 X:71750433-71750455 TTATCCAGTCTACCATTGATGGG + Intergenic
1192518474 X:71777731-71777753 TTATCCAGTCTACCATTGATGGG - Intergenic
1192685324 X:73298849-73298871 TTATCCAGTCTACCATTGATGGG - Intergenic
1192725013 X:73740670-73740692 TTGTCCAGTCTATCATTGATGGG - Intergenic
1192767158 X:74152429-74152451 TTATCCAGTCTACCATTGATGGG - Intergenic
1192973884 X:76262167-76262189 TTATCTAGTCTATCATTGATGGG + Intergenic
1192992619 X:76476971-76476993 TTATCCGGTCTATCATTGATGGG - Intergenic
1193003207 X:76585935-76585957 TTATCTAGTCTATCATTGATGGG + Intergenic
1193028524 X:76872733-76872755 TTATCCAGTCTACCATTGATGGG - Intergenic
1193093090 X:77515351-77515373 TTATCCAGTCTACCATTGATAGG - Intronic
1193120924 X:77822228-77822250 TTATCTAGTCTATCATTGATGGG + Intergenic
1193182748 X:78478079-78478101 TTATCTAGTCTATCATTGATGGG + Intergenic
1193188125 X:78537805-78537827 TTATCTAGTCCACCATTGATGGG + Intergenic
1193207570 X:78766487-78766509 TTATCCAGTCTACCATTGATGGG + Intergenic
1193217813 X:78885250-78885272 TTATCTGGTCTATCATTGATGGG - Intergenic
1193302428 X:79905467-79905489 TTTCCTAGTCTACCATTGATGGG - Intergenic
1193343061 X:80374228-80374250 TTATCCAGTCTACCATTGATGGG + Intronic
1193402163 X:81058128-81058150 TTATCCAGTCTACCATTGATGGG - Intergenic
1193404973 X:81089633-81089655 TTATCTGGTCTATCATTGATGGG - Intergenic
1193616111 X:83689368-83689390 TTATCTAGTCTGCCATTGATGGG + Intergenic
1193748355 X:85311573-85311595 TTATCTAGTCTATCATTGATGGG + Intronic
1193755331 X:85402398-85402420 TTATCTAGTCTATCATTGATGGG + Intergenic
1193898860 X:87150347-87150369 TCATCTAGTCTGCCATTGATGGG + Intergenic
1193973386 X:88086125-88086147 TTATCCAGTCTACCATTGATGGG + Intergenic
1194109221 X:89811528-89811550 TTATCTAGTCTAGCATTGATGGG - Intergenic
1194116544 X:89906055-89906077 TTATATAGTCTACCATTGATGGG - Intergenic
1194153912 X:90362956-90362978 TTATCCAGTCTACCATTGATAGG + Intergenic
1194260690 X:91691442-91691464 TTCTCTGATCCACCATTGATGGG - Intergenic
1194281017 X:91954344-91954366 TTATCCGGTCTATCATTGATGGG + Intronic
1194319117 X:92421496-92421518 TTATCTGGTGTTCCATTGATGGG + Intronic
1194347070 X:92779083-92779105 CAGTCTAGTCTACCATTGATGGG - Intergenic
1194551208 X:95301880-95301902 TTATTTAGTCTACCATTGATGGG - Intergenic
1195024016 X:100857266-100857288 TTATCCAGTCTACCATTGATGGG + Intronic
1195121094 X:101753346-101753368 TTATCCAGTCTACCATTGATGGG - Intergenic
1195130914 X:101850928-101850950 TTGTCCAGTCTATCATTGATGGG + Intronic
1195288839 X:103411977-103411999 TTATCCAGTCTACCATTGATGGG + Intergenic
1195305864 X:103583468-103583490 TTATCTAGTCTATCATTGATGGG - Intronic
1195355422 X:104034978-104035000 TTGTCCAGTCTATCATTGATGGG + Intergenic
1195414017 X:104600902-104600924 TTGTCCAGTCCACCATTGATGGG + Intronic
1195483091 X:105370612-105370634 TTACCTAGTCTACCATTGATAGG + Intronic
1195629348 X:107038146-107038168 TTATCCAGTCTACCATTGATGGG - Intergenic
1195671232 X:107471685-107471707 TTATCCGGTCTATCATTGATGGG + Intergenic
1195754120 X:108184096-108184118 TAGTCTGGGCTACCATTGATTGG + Intronic
1195986106 X:110632061-110632083 TTATCTAGTCTATCATTGATGGG - Intergenic
1196126268 X:112103187-112103209 TTATCTAGTCTATCATTGATGGG - Intergenic
1196214099 X:113030148-113030170 TTATCTAGTCTATCATTGATGGG - Intergenic
1196335288 X:114525217-114525239 TTATCTAGTCTATCATTGATGGG - Intergenic
1196486726 X:116219130-116219152 TTATCCTGTCTACCATTGATGGG - Intergenic
1196559724 X:117130966-117130988 TTATCTAGTCTACCATTGATGGG - Intergenic
1196579582 X:117363042-117363064 TTATCTAGTCTATCATTGATGGG - Intergenic
1196584537 X:117414770-117414792 TTATCTAGTCTACAATTGATGGG - Intergenic
1196584667 X:117416323-117416345 TTATCTGGTCTATCATTGATGGG + Intergenic
1196909393 X:120469910-120469932 TTATCTAGTCTATCATTGATGGG + Intergenic
1197040176 X:121927788-121927810 TTATCCAGTCTACCATTGATGGG - Intergenic
1197184157 X:123568152-123568174 TTATCCGGTCTATCATTGATGGG - Intergenic
1197336049 X:125210591-125210613 TGATCTGATATACCGTTGATAGG + Intergenic
1197366945 X:125574864-125574886 TTGTCCAGTCTACCATTGATGGG - Intergenic
1197422242 X:126252411-126252433 TTATCTAGTCTACCATTGATGGG + Intergenic
1197431022 X:126363971-126363993 TTTTCTAGTCTATCATTGATGGG - Intergenic
1197617026 X:128704435-128704457 TTATCTAGTCTATCATTGATGGG - Intergenic
1197791043 X:130254513-130254535 TCATCCAGTCTACCATTGATGGG - Intronic
1198313259 X:135440435-135440457 TTATCCGGTCTACCATTGATGGG - Intergenic
1198556788 X:137802569-137802591 TCATCCAGTCTACCATTGATGGG + Intergenic
1198733210 X:139756577-139756599 TTATCCAGTCTACCATTGATGGG - Intronic
1198895089 X:141444889-141444911 TGTGCTGTTCTACCATTGTTAGG - Intergenic
1199253232 X:145688997-145689019 TTCTTTAGTCTACCATTGATGGG + Intergenic
1199271923 X:145894087-145894109 TTATCCAGTCTACCATTGATGGG + Intergenic
1199300683 X:146210184-146210206 TTATCCAGTCTACCATTGATAGG + Intergenic
1199368204 X:147013688-147013710 TTATCTAGTCTACCATTGCTGGG - Intergenic
1199414709 X:147567978-147568000 TGATCCAGTCTACCATTGATGGG + Intergenic
1199791409 X:151158681-151158703 TTATCTAGTCTATCATTGATGGG + Intergenic
1200332605 X:155313470-155313492 TTATCCAGTCTACCATTGATGGG - Intronic
1200461883 Y:3466271-3466293 TTATCTAGTCTAGCATTGATGGG - Intergenic
1200469343 Y:3563238-3563260 TTATATAGTCTACCATTGATGGG - Intergenic
1200500263 Y:3939835-3939857 TTATCCAGTCTACCATTGATAGG + Intergenic
1200557744 Y:4658074-4658096 TAATCCAGTCTACCATTGATGGG - Intergenic
1200579378 Y:4930506-4930528 TTCTCTGATCCACCATTGATGGG - Intergenic
1200627246 Y:5534585-5534607 TTATCTGGTGTTCCATTGATGGG + Intronic
1200743707 Y:6883201-6883223 TTATCTAGTCTATCATTGATGGG - Intergenic
1201294401 Y:12451328-12451350 TTGTCCAGTCTACCATTGATGGG - Intergenic
1201623798 Y:15990181-15990203 TTATCTCGTCTATCATTGATGGG - Intergenic
1201866705 Y:18663455-18663477 TTATCTAGTCTATCATTGATGGG + Intergenic
1202056143 Y:20832818-20832840 TTATCTGGTCTACCATTGATGGG + Intergenic