ID: 912694070

View in Genome Browser
Species Human (GRCh38)
Location 1:111827801-111827823
Sequence CAGGGTATCCTGGAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912694070_912694085 25 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694085 1:111827849-111827871 AAGAAGAAATGGGGCTCCAAGGG No data
912694070_912694082 15 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694082 1:111827839-111827861 TGAGCAGAGGAAGAAGAAATGGG 0: 1
1: 0
2: 8
3: 85
4: 774
912694070_912694074 -10 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694074 1:111827814-111827836 GGATACCCTGATGACCAGCCAGG No data
912694070_912694075 -9 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694075 1:111827815-111827837 GATACCCTGATGACCAGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 104
912694070_912694083 16 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694083 1:111827840-111827862 GAGCAGAGGAAGAAGAAATGGGG No data
912694070_912694081 14 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694081 1:111827838-111827860 CTGAGCAGAGGAAGAAGAAATGG No data
912694070_912694084 24 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694084 1:111827848-111827870 GAAGAAGAAATGGGGCTCCAAGG 0: 1
1: 0
2: 0
3: 32
4: 351
912694070_912694078 2 Left 912694070 1:111827801-111827823 CCCTCCTGCTCCAGGATACCCTG No data
Right 912694078 1:111827826-111827848 GACCAGCCAGGGCTGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912694070 Original CRISPR CAGGGTATCCTGGAGCAGGA GGG (reversed) Intronic
No off target data available for this crispr