ID: 912695407

View in Genome Browser
Species Human (GRCh38)
Location 1:111837985-111838007
Sequence ATGTGGATCATATGTGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912695407_912695412 20 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695412 1:111838028-111838050 AACCTTGCTCACCTGGGCTGAGG 0: 1
1: 0
2: 1
3: 37
4: 378
912695407_912695410 13 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695410 1:111838021-111838043 CGAGGTCAACCTTGCTCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 225
912695407_912695409 -5 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695409 1:111838003-111838025 CACATAACGCGTCACTGTCGAGG No data
912695407_912695411 14 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695411 1:111838022-111838044 GAGGTCAACCTTGCTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912695407 Original CRISPR ATGTGGATCATATGTGCCCT CGG (reversed) Intronic
900830365 1:4961004-4961026 ATGTGGATGAGCTGTGCCCATGG - Intergenic
911000931 1:93164719-93164741 ATGTGAATCGTGTGTGCCCTAGG - Intronic
912695407 1:111837985-111838007 ATGTGGATCATATGTGCCCTCGG - Intronic
918483086 1:185000724-185000746 ATGTGGATGAGATATGCCCTGGG - Intergenic
920057838 1:203205781-203205803 ATGTGGCTTATCTGTGCCCACGG - Intergenic
921342662 1:214149962-214149984 ATGTTGATAGTATGTACCCTTGG + Intergenic
921397586 1:214684987-214685009 ATGTTGATAGTATGTGCCCTTGG - Intergenic
921888124 1:220326733-220326755 ATGTGGCTCATACTTTCCCTGGG - Intergenic
923133388 1:231096632-231096654 ATGTGGCTGACATTTGCCCTTGG + Intergenic
923937305 1:238777414-238777436 CTCTGGATCAAATCTGCCCTGGG - Intergenic
1068839184 10:61591096-61591118 ATGTCGATAAAATGTACCCTTGG + Intergenic
1074504921 10:114061312-114061334 CCGTGAATCATATGTGCCCCAGG - Intergenic
1075495316 10:122914707-122914729 AGGTGGATAATCTGAGCCCTGGG + Intergenic
1076346441 10:129781879-129781901 ATGTGGCTCATAAATGCCCCTGG - Intergenic
1080456326 11:32422982-32423004 ATGAGGATCATATGTGAAGTCGG + Intronic
1080862541 11:36162517-36162539 ATGTGAATCAGTGGTGCCCTGGG + Intronic
1081401851 11:42653102-42653124 AGGAGGATCATCTGAGCCCTGGG - Intergenic
1082096836 11:48137800-48137822 ATGTGGATGATATCTGGCATTGG + Intronic
1085555921 11:77421518-77421540 TTGTGGAGCATATGTTCCATTGG - Intronic
1086646020 11:89221261-89221283 ATGTGGAGTGTTTGTGCCCTGGG + Intronic
1087679560 11:101204197-101204219 ATGTGGTTCATATATACCATGGG - Intergenic
1088160380 11:106862971-106862993 TTGTGAATCATCTGTGACCTGGG + Intronic
1089230785 11:116973691-116973713 ATGTTGATAGTATGTGCCCTTGG + Intronic
1089925820 11:122256206-122256228 ATGTGTCTCATTTGTGCCCACGG - Intergenic
1090643146 11:128746351-128746373 GTGTGGATGGCATGTGCCCTTGG - Intronic
1092667490 12:10819679-10819701 ATGTGTATGATATTTGGCCTAGG - Intergenic
1096651566 12:53064459-53064481 ATGGGAATCATATGTTCCATGGG - Exonic
1098390992 12:69969718-69969740 AAGTAGAGCATATGTGTCCTGGG - Intergenic
1100707749 12:97220080-97220102 ATGTGGACCATATTCTCCCTGGG - Intergenic
1101353607 12:103956458-103956480 ATTAGGATCACATTTGCCCTGGG - Intronic
1101367790 12:104091377-104091399 ATGTGGCCCATTTGTGCCCCAGG - Intronic
1102459501 12:113091594-113091616 GTGTGGATGGTGTGTGCCCTGGG + Intronic
1104032924 12:125078299-125078321 ATGTGCATCAGAAGTGCCCATGG - Intronic
1105410792 13:20169580-20169602 AGGAGGAACAGATGTGCCCTGGG + Intergenic
1107283932 13:38768370-38768392 AGGTGGATCACCTGAGCCCTAGG - Intronic
1108182655 13:47856017-47856039 ATGTGGATCACTTGAGCCCATGG - Intergenic
1109578081 13:64288348-64288370 ATGTGGATGATGGGTGCACTAGG + Intergenic
1112920760 13:104609606-104609628 ATGGGGAGCACATCTGCCCTGGG - Intergenic
1114953153 14:27782283-27782305 ATGTGGATCATTTCTGATCTGGG - Intergenic
1115356257 14:32451508-32451530 ATGTGTATAAAATGTGCACTTGG + Intronic
1117341999 14:54799954-54799976 GTCTGGATCATCTGTCCCCTGGG - Intergenic
1120909712 14:89655112-89655134 AAGTGGATGATATGTGTACTGGG + Intergenic
1122567050 14:102666784-102666806 ATGTTGATGGTATGTACCCTTGG - Intronic
1129850962 15:78793755-78793777 ATGGGGAACAGATGTTCCCTCGG - Intronic
1131463542 15:92637031-92637053 ATCTGTATCCTCTGTGCCCTGGG + Intronic
1133245444 16:4445776-4445798 GGGTGGATCATTTGAGCCCTGGG - Intronic
1138220044 16:55242619-55242641 AATTGGATCACATGTGGCCTTGG - Intergenic
1140545958 16:75809439-75809461 ATATGGGTTATATGTGCTCTAGG + Intergenic
1144007219 17:11111721-11111743 ATGTTGGTCATATGCTCCCTCGG + Intergenic
1147633057 17:41944970-41944992 ATGTGGCACATCTGTGCCCTGGG - Intronic
1147837932 17:43348353-43348375 TTGTGGATCTTCTTTGCCCTTGG - Intergenic
1150583778 17:66499168-66499190 ATGTGGATCATTTTTGCCTAGGG + Intronic
1151634046 17:75331853-75331875 ATGTGGCTTATATGGGACCTGGG + Intronic
1155015481 18:21834550-21834572 ATGTTGATAGTATGTACCCTTGG + Intronic
1156699063 18:39801274-39801296 ATGTGTGTCATATGTGTCATAGG + Intergenic
1159955201 18:74514023-74514045 ATGTGGCTTAAATGAGCCCTGGG - Intronic
1160433382 18:78827650-78827672 ATGTGGATCGGCTGTTCCCTGGG - Intergenic
1165803004 19:38564431-38564453 ATGGGGATCATGTGAACCCTGGG + Intronic
1166593174 19:44019439-44019461 ATGTGCATTATAGGTGTCCTGGG + Intergenic
1166911655 19:46163422-46163444 AGGTGGAGCATCTGTGCCGTGGG + Intergenic
1168584466 19:57581962-57581984 AGGTGGGTCATTTGTCCCCTGGG + Intronic
927922559 2:26984576-26984598 ATTTGGAGCATATGTTTCCTTGG - Intronic
930122195 2:47769386-47769408 ATGTGGATCATGTTTGCCACTGG - Intronic
932986470 2:76731653-76731675 ATGAGGATCATATCTTCACTTGG - Intergenic
933056380 2:77672859-77672881 ATGTGGAACACATGAGACCTAGG + Intergenic
933927936 2:87117174-87117196 ATGTGGAACACATGAGACCTAGG + Intergenic
938273706 2:129997528-129997550 ATCTGGATCATGTTTGCTCTAGG - Intergenic
943933527 2:193885596-193885618 ATGAGGGTGATATGTGACCTAGG + Intergenic
944120635 2:196236795-196236817 ATGTTGATAATATGTACCCTCGG - Intronic
945752830 2:213809720-213809742 AAGTGCATCATGTGGGCCCTTGG - Intronic
1180672670 22:17565463-17565485 AGGAGGATCATTTGAGCCCTGGG - Intronic
1182078762 22:27514004-27514026 ATGTGGGTCATAATTGCCTTAGG + Intergenic
949291138 3:2467341-2467363 ATGTTAATTATATTTGCCCTTGG + Intronic
951463534 3:22977153-22977175 ATGTGGACCCCATGTGCTCTGGG - Intergenic
951682781 3:25311774-25311796 CTATGTACCATATGTGCCCTGGG - Intronic
958815810 3:98914270-98914292 ATATGGATGATATGTAGCCTGGG - Intergenic
961253245 3:125524004-125524026 GTGTGGATGACATTTGCCCTTGG + Intergenic
963276212 3:143332650-143332672 AAGTGGTTCATTTGTGCCCAAGG + Intronic
963874112 3:150454286-150454308 CTGTGGAACATATGTTCTCTCGG - Intronic
967282499 3:187835839-187835861 ATTGGGATGATATGTGCTCTTGG - Intergenic
969304064 4:6315223-6315245 ATGAGGAACACATGTGCCTTAGG - Intergenic
969691727 4:8707556-8707578 ATGGGGTTCAGCTGTGCCCTGGG + Intergenic
972064324 4:34921345-34921367 ATGTGTATCTTATGTGCTGTGGG - Intergenic
975980632 4:80154667-80154689 ATGAGGATAATATCTTCCCTGGG - Intergenic
979601199 4:122588039-122588061 AGGTGGTTCATATGTGGCCAAGG - Intergenic
985228159 4:187784750-187784772 AATTGGATCATATGTGGGCTTGG - Intergenic
985911380 5:2886679-2886701 ATGTAAATAAAATGTGCCCTGGG + Intergenic
986795757 5:11210304-11210326 ATGGGGATCATTTGAGCCCAGGG + Intronic
987300416 5:16592680-16592702 ATGTGGTACATATACGCCCTAGG + Intronic
988623223 5:32844740-32844762 ATTTGGAACATATATTCCCTTGG + Intergenic
989617910 5:43356000-43356022 ATGTTGATAGTATGTACCCTTGG - Intergenic
994750804 5:103734640-103734662 ATATGGAACATATGTGTTCTAGG + Intergenic
995232555 5:109785434-109785456 ATGTGGATGATATAAGCCATTGG + Intronic
1002456231 5:179346469-179346491 CTGTTGATCATCTCTGCCCTGGG + Intergenic
1007351203 6:41274896-41274918 CTGAGGATAATATCTGCCCTGGG + Intronic
1008727652 6:54441639-54441661 AATTGGATCATATGTGGGCTTGG + Intergenic
1011325717 6:86148617-86148639 GATTGGATCATATGTGGCCTTGG + Intergenic
1012365098 6:98429312-98429334 AGGTGGATCATATGAGGCCAGGG + Intergenic
1023510317 7:40945696-40945718 ATGTGGATTATTTGTTCCCATGG + Intergenic
1024122480 7:46258839-46258861 ATGTTGATAGTATGTGTCCTTGG - Intergenic
1025216114 7:57057983-57058005 AGGTGGATCATCTGAGGCCTAGG + Intergenic
1025626848 7:63230388-63230410 AGGTGGATCATCTGAGGCCTAGG + Intergenic
1025655266 7:63512720-63512742 AGGTGGATCATCTGAGGCCTAGG - Intergenic
1032415920 7:131735451-131735473 AAGTGGCTCAGATGTGACCTTGG - Intergenic
1033480204 7:141732748-141732770 ATGTGTATCATAAATGCCCAGGG - Intergenic
1034407854 7:150917130-150917152 ATGCTTATTATATGTGCCCTTGG - Intergenic
1035059995 7:156062164-156062186 GTGTAGAGCAGATGTGCCCTAGG - Intergenic
1041583053 8:59484679-59484701 AAGTAGATCATTTGTGCCTTGGG + Intergenic
1043338566 8:79208193-79208215 ATGTTGATGGTATGTACCCTTGG - Intergenic
1048449789 8:134523307-134523329 TTGTGGATAATATATGTCCTGGG - Intronic
1056935777 9:90913991-90914013 ATGAGGGTCATATCTGCCCAGGG + Intergenic
1061020835 9:128013445-128013467 AGGTGGATCATTTGTGGCCAGGG + Intergenic
1187180905 X:16942987-16943009 AGGTGGATCACTTGAGCCCTAGG + Intergenic
1187372196 X:18718901-18718923 ATGCGGATCGTATTTGACCTTGG + Intronic
1189626470 X:42902528-42902550 ATGTTGATAACATGTGCCATTGG + Intergenic
1191781240 X:64868612-64868634 ATGTGGAACACATGTTCCATGGG + Intergenic
1192737827 X:73865187-73865209 AGGTGGATCACTTGAGCCCTGGG + Intergenic
1196526204 X:116729433-116729455 ATATGCATCATATGTGTCATAGG - Intergenic
1199520253 X:148726871-148726893 ATGGGGACCATGTGTGCCCTGGG - Intronic
1199634446 X:149802436-149802458 AGGGGGACCACATGTGCCCTCGG - Intergenic
1201266416 Y:12211399-12211421 GGGTGGCTCATATATGCCCTAGG - Intergenic
1201781918 Y:17732191-17732213 ATGTGGAACATATATACCATGGG - Intergenic
1201819635 Y:18173799-18173821 ATGTGGAACATATATACCATGGG + Intergenic