ID: 912695408

View in Genome Browser
Species Human (GRCh38)
Location 1:111838002-111838024
Sequence CTCGACAGTGACGCGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 11}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912695408_912695415 16 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695415 1:111838041-111838063 TGGGCTGAGGTCATTTTGCCAGG 0: 1
1: 0
2: 1
3: 16
4: 141
912695408_912695410 -4 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695410 1:111838021-111838043 CGAGGTCAACCTTGCTCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 225
912695408_912695411 -3 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695411 1:111838022-111838044 GAGGTCAACCTTGCTCACCTGGG No data
912695408_912695412 3 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695412 1:111838028-111838050 AACCTTGCTCACCTGGGCTGAGG 0: 1
1: 0
2: 1
3: 37
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912695408 Original CRISPR CTCGACAGTGACGCGTTATG TGG (reversed) Intronic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1107889943 13:44905401-44905423 CTGGATAGGGACGAGTTATGTGG + Intergenic
1153131922 18:1863653-1863675 CTCTACAGTGAAGCGTTGTCTGG - Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
946132047 2:217614024-217614046 CTTGACAGTGATGTGGTATGGGG + Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
1182002080 22:26927809-26927831 CCCGACAGAGAGGCGTTATGGGG + Intergenic
952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG + Intergenic
982387089 4:154819491-154819513 CAAGACAGTGACGAATTATGGGG - Intronic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic