ID: 912695410

View in Genome Browser
Species Human (GRCh38)
Location 1:111838021-111838043
Sequence CGAGGTCAACCTTGCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912695407_912695410 13 Left 912695407 1:111837985-111838007 CCGAGGGCACATATGATCCACAT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 912695410 1:111838021-111838043 CGAGGTCAACCTTGCTCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 225
912695408_912695410 -4 Left 912695408 1:111838002-111838024 CCACATAACGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 3
4: 11
Right 912695410 1:111838021-111838043 CGAGGTCAACCTTGCTCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912695410 Original CRISPR CGAGGTCAACCTTGCTCACC TGG Intronic
900230268 1:1553428-1553450 CGAGATCATCCTTGCTAACATGG + Intronic
902519146 1:17005932-17005954 CGAGATCAACCTGGCTAACATGG + Intronic
908001794 1:59687668-59687690 CGAGGTCATCCTGGCTAACACGG - Intronic
908087229 1:60648541-60648563 TGATATTAACCTTGCTCACCCGG - Intergenic
908314756 1:62921910-62921932 CGATGTAGACCTTGATCACCTGG + Intergenic
911457742 1:98148171-98148193 TGATGTTAACCTTGATCACCTGG - Intergenic
911578489 1:99606516-99606538 TGATGTCAACCTTGGTCACACGG + Intergenic
911861938 1:102962678-102962700 CCAGGAAGACCTTGCTCACCAGG + Exonic
912120668 1:106467843-106467865 CGAGGTCCACCTCACCCACCAGG + Intergenic
912695410 1:111838021-111838043 CGAGGTCAACCTTGCTCACCTGG + Intronic
914383690 1:147146323-147146345 TCATGTCAAGCTTGCTCACCTGG + Intergenic
914711928 1:150222216-150222238 CGAGAGCAACCTTGCTAACACGG + Intronic
916190701 1:162175075-162175097 TGATGTTAACCTTGATCACCTGG + Intronic
921018250 1:211212172-211212194 CGAGGTCATCCTGGCTAACACGG + Intergenic
924127098 1:240866307-240866329 CGAGATCATCCTTGCTAACACGG + Intronic
1063989333 10:11543337-11543359 CGAGGTCATCCTGGCTAACACGG + Intronic
1064605201 10:17032051-17032073 CGAGGTCTATCTTCCTCTCCAGG - Intronic
1066792771 10:39084213-39084235 CGAGGTCATCCTGGCTAACATGG - Intergenic
1070809652 10:79291173-79291195 ACAGGTCAGCCCTGCTCACCTGG - Exonic
1071320014 10:84445353-84445375 CGAGGTCATCCTGGCTAACATGG - Intronic
1071567503 10:86679396-86679418 CGAGGTCACCCTGGCTGAGCTGG - Exonic
1072316464 10:94208195-94208217 TGATGTCAATCTTGATCACCTGG - Intronic
1072461350 10:95621510-95621532 CGAGATCAACCTGGCCAACCTGG - Intronic
1073402278 10:103268148-103268170 CGAGATCAGCCTTGCCAACCTGG + Intergenic
1074047905 10:109855746-109855768 TGAGGTTAACCTTGATCATCTGG - Intergenic
1074183854 10:111084939-111084961 TGAGGACCACTTTGCTCACCTGG + Intergenic
1075361699 10:121842647-121842669 TGAAGTCAGCCTTGCACACCTGG - Intronic
1075999282 10:126902858-126902880 CGAGGTCAGCCTGGCCAACCAGG - Intergenic
1076993294 11:286808-286830 CGAGATCATCCTGGCTCACACGG + Intergenic
1077387244 11:2275833-2275855 TGAAGTCACCCTTGGTCACCAGG - Intergenic
1077661733 11:4074574-4074596 TGAGATCAACCTTGCTAAGCAGG + Exonic
1079142688 11:17823317-17823339 TGATGTTAACCTTGGTCACCTGG + Intronic
1080375102 11:31699733-31699755 TGATGTCAACCTTGATCATCTGG - Intronic
1081610523 11:44560161-44560183 CGAGGTCATCCTGGCTAACATGG + Intergenic
1081836276 11:46157813-46157835 TGATGTTAACCTTGATCACCTGG + Intergenic
1085094428 11:73747924-73747946 CGATGTTAACCTTGATCACTTGG + Intronic
1085621468 11:78041048-78041070 CTGGGTCAACCTGGCTTACCAGG - Intronic
1086073176 11:82821411-82821433 CGAGATCATCCTTGCTAACACGG + Intergenic
1086956143 11:92936238-92936260 CGAGATCAACCTGGCTAACACGG + Intergenic
1089692643 11:120196501-120196523 CAAGGCCAACCATGCTCTCCTGG - Intergenic
1090448334 11:126783873-126783895 TGCTGCCAACCTTGCTCACCTGG - Intronic
1092073436 12:5652797-5652819 TGATGTCAACCTTGATCTCCTGG + Intronic
1095561333 12:43569644-43569666 CGAGATCATCCTTGCTGACATGG - Intergenic
1095666282 12:44803007-44803029 TGATATTAACCTTGCTCACCGGG - Intronic
1095960091 12:47828933-47828955 AAAGGTCAACCTTGCCCCCCTGG - Intronic
1096655533 12:53088953-53088975 TGAGGTTAACCTTGATCACTTGG + Intergenic
1097397226 12:59090391-59090413 TGATGTTAACCTTGATCACCTGG - Intergenic
1097497269 12:60356221-60356243 CGAGGCCAACTTTGCTAGCCAGG + Intergenic
1098867342 12:75778375-75778397 CGAGGTCAGCCTGGCTGACATGG + Intergenic
1099370186 12:81819268-81819290 CGAGATCAACCTGGCTAACATGG + Intergenic
1099675207 12:85751788-85751810 TGATGTCAACCTTGCTCACCTGG - Intergenic
1100269672 12:93012707-93012729 TGATATCAACCTTGCTCAACTGG + Intergenic
1101444763 12:104729849-104729871 CCTGGTGGACCTTGCTCACCAGG - Intronic
1102329494 12:112016686-112016708 CGAGGTCATCCTGGCTAACACGG + Intronic
1103217223 12:119211325-119211347 CGAGATCATCCTGGCTAACCCGG - Intronic
1104919567 12:132283510-132283532 AGAGGACAGCCCTGCTCACCTGG + Intronic
1105029101 12:132870148-132870170 CGAGGCCAACCTGGCTAACACGG + Intronic
1106902787 13:34371848-34371870 TGATGTCAACCTTGGTCACTTGG - Intergenic
1107219593 13:37966542-37966564 TGATGTAAACCTTGGTCACCTGG + Intergenic
1107742384 13:43465070-43465092 TGATGTTAACCTTGATCACCTGG + Intronic
1107838563 13:44432957-44432979 CAAGGACATCCTTGCTCATCTGG + Intronic
1110674280 13:78221687-78221709 CGAGGTCATCCTGGCTAACAAGG + Intergenic
1113198117 13:107833221-107833243 CAAGGTCTACATTGCTCACCAGG + Intronic
1113334077 13:109361416-109361438 CCAGTTCTACCTTTCTCACCAGG + Intergenic
1114465312 14:22918192-22918214 CGAGGTCAGCCTGGCTAACATGG + Intronic
1115626751 14:35201194-35201216 TGATGTTAACCTTGATCACCTGG + Intronic
1116116255 14:40654752-40654774 TGACGTTAACCTTGATCACCTGG - Intergenic
1118883309 14:69846939-69846961 CGATGTTGACCTTGATCACCTGG + Intergenic
1124257181 15:28153778-28153800 CGAGGCCAACTTTCCTCACTAGG - Intronic
1124466683 15:29946467-29946489 TGAGGTTAACCTTGCTGGCCTGG - Intronic
1124567150 15:30826719-30826741 CGAGGCCAACTTTACTCACTAGG + Intergenic
1125554419 15:40572358-40572380 CGAGGTCATCCTGGCTAACACGG + Intronic
1127032386 15:54878130-54878152 TGACGTCAACTTTGATCACCTGG - Intergenic
1127578180 15:60312973-60312995 TGATGTCATCCTTGATCACCGGG + Intergenic
1128109498 15:65067757-65067779 CGAGGTCAACCTGGCCATCCTGG - Exonic
1129381438 15:75170036-75170058 GGAGGTCATCCTTCCCCACCTGG + Intergenic
1133021427 16:2968647-2968669 GGAGGTCGACTTTGCTCCCCTGG + Intronic
1133822791 16:9251538-9251560 CGAGATCATCCTGGCTCACACGG - Intergenic
1133873615 16:9712528-9712550 CGAGGTCAATGTTGCTCATATGG - Intergenic
1134723599 16:16401479-16401501 CGAGACCAGCCTTGCTCACATGG + Intergenic
1134943830 16:18310391-18310413 CGAGACCAGCCTTGCTCACATGG - Intergenic
1137310978 16:47258135-47258157 TGATGTTAACCTTGTTCACCTGG - Intronic
1139798809 16:69504523-69504545 CGAGGTCATCCTGGCTAACACGG + Intergenic
1141166577 16:81664783-81664805 CGATGTTGACCTTGATCACCTGG - Intronic
1142340322 16:89517819-89517841 CGAGATCATCCTAGCTCACATGG - Intronic
1143214251 17:5212430-5212452 CGAGATCATCCTTGCTAACATGG + Intronic
1147805734 17:43129674-43129696 CGAGGTCATCCTGGCTAACGCGG - Intergenic
1149126034 17:53234267-53234289 CAATGTTAACCTTGATCACCTGG - Intergenic
1149683137 17:58519386-58519408 CGAGGTCATCCTGGCTAACACGG + Intergenic
1150345428 17:64401023-64401045 CGAGGTCATCCTGGCTAACACGG + Intronic
1150475780 17:65473486-65473508 CAAGGTGAACCTTGTTCACGGGG + Intergenic
1150574014 17:66413811-66413833 CGAGGTCAGCCTTGCCAACATGG + Intronic
1151147111 17:72051451-72051473 TGATGTTAACCTTGATCACCTGG - Intergenic
1151364499 17:73608373-73608395 CTATGTTAACCTTGATCACCTGG + Intronic
1151643683 17:75414980-75415002 CGAGGCCATCCTGGCTAACCCGG + Intergenic
1152833727 17:82515803-82515825 CGAGGTCATCCTGGCTAACACGG - Intergenic
1157137666 18:45072824-45072846 TGATGTTAACCTTGATCACCTGG + Intergenic
1157688139 18:49659479-49659501 TGATGTTAACCTTGATCACCTGG + Intergenic
1158340496 18:56460777-56460799 GGAGGTCAACCCTGCCCACAAGG - Intergenic
1160964967 19:1743313-1743335 CGGGGTCCTCCTTGCACACCTGG + Intergenic
1161534640 19:4811608-4811630 CGAGGCCAGCCTGGCTGACCTGG + Intergenic
1161774083 19:6248449-6248471 CGAGGTTGACCTTGATCTCCTGG - Intronic
1163187642 19:15650171-15650193 AGAGGCCCACCTTGCTCAGCAGG - Exonic
1163217157 19:15889413-15889435 AGAGGCCCACCTTGCTCAGCAGG + Exonic
1163606140 19:18276561-18276583 CGAGATCAACCTGGCTAACACGG + Intergenic
1165289324 19:34870364-34870386 CGAGGCCATCCTGGCTAACCTGG + Intergenic
1166848918 19:45748280-45748302 CGAGGTCATCCTGGCTAACACGG - Intronic
1167889125 19:52526038-52526060 CGAGGTCATCCTGGCTAACATGG - Intergenic
925174038 2:1769950-1769972 CAAGGTCCACCTTGGGCACCTGG - Intergenic
925966111 2:9067807-9067829 TGATGTTGACCTTGCTCACCTGG + Intergenic
927823792 2:26292904-26292926 TGATGTTAACCTTGATCACCTGG - Intergenic
927925009 2:27005978-27006000 CGAGATCATCCTTGCTAACACGG + Intronic
928043331 2:27900839-27900861 CGAGGTCATCCTGGCTAACACGG + Intronic
928345507 2:30490405-30490427 CGAGGTCATCCTGGCTAACACGG - Intronic
928876583 2:36047160-36047182 TGATGTTAACCTTGATCACCTGG - Intergenic
930668142 2:54120097-54120119 TGATGTTAACCTTGATCACCTGG + Intronic
930805131 2:55482919-55482941 CGAGGTCAACCTGGCCAACATGG + Intergenic
932047014 2:68359751-68359773 TGATGTTAACCTTGATCACCTGG + Intergenic
933797684 2:85933388-85933410 TGATGTTAACCTTGATCACCTGG + Intergenic
937244752 2:120485380-120485402 CGAGGGCAACTTTGATCAACTGG + Intergenic
939873422 2:147549917-147549939 CGAGATCAACCTGGCTAACATGG + Intergenic
940026319 2:149212173-149212195 CGAGGTCATCCTGGCTAACATGG + Intronic
940845010 2:158631140-158631162 CGAGATCAACCTGGCTAACACGG - Intronic
942171498 2:173294191-173294213 CGAGATCATCCTGGCTAACCTGG - Intergenic
942711049 2:178836997-178837019 CGTGGTCAGCCTAGCTGACCAGG - Exonic
942717203 2:178906789-178906811 CCAGCTCAACCTTGCTCGCCTGG - Intronic
944282853 2:197918052-197918074 TGAGGTTAACCTTGCTCACCTGG - Intronic
947909620 2:233792513-233792535 CGAGGTCATCCTGGCTAACACGG - Intronic
948566419 2:238890098-238890120 CCAGGTGAACCTCGCTCTCCAGG - Intronic
1170696782 20:18666289-18666311 TGATGTTAACCTTGATCACCTGG + Intronic
1173504898 20:43579205-43579227 CGAGGTCAACCATGTTGACCAGG + Intronic
1175357370 20:58379427-58379449 CGATGTTGACCTTGATCACCTGG + Intergenic
1175803419 20:61813916-61813938 CCTGGCCCACCTTGCTCACCAGG + Intronic
1178147429 21:29756177-29756199 CGAGTTCAACCTGGCTAACACGG + Intronic
1179555397 21:42172335-42172357 CGAGGTCATCCTGGCTAACTCGG - Intergenic
1181758069 22:25039455-25039477 GGAGGTCACCCCTGCTGACCTGG + Exonic
1183053220 22:35282376-35282398 CGAGGTCATCCTGGCTAACACGG - Intronic
1185020296 22:48370555-48370577 CGAGGTGAACTTCGCTCAGCAGG - Intergenic
949553229 3:5130062-5130084 CGAGGTCAGCCTTGCCAACATGG - Intronic
951085112 3:18503209-18503231 CGAGGCCAACCTGGCTAACACGG - Intergenic
951929983 3:27954716-27954738 CGAGATCAACCTGGCTAACATGG + Intergenic
952527756 3:34230053-34230075 CGAGGCCAGCCTTGTTCACATGG + Intergenic
953024609 3:39137650-39137672 CGAGGTCGAACTTGCTGCCCTGG - Exonic
953216525 3:40923821-40923843 TGAGGCCAGCCTAGCTCACCAGG + Intergenic
953966502 3:47311209-47311231 CGAGGTCATCCTGGCTAACATGG - Intronic
954594963 3:51816456-51816478 CGAGGCCAACCTGGCTAACGTGG + Intergenic
954640442 3:52094507-52094529 CTAGGCCAACCTTTCTCTCCTGG - Intronic
957933339 3:86911167-86911189 CGAGGCCAACCTGGCTAACACGG + Intergenic
958622439 3:96578502-96578524 TGAGGTTAATCTTGGTCACCTGG - Intergenic
958928245 3:100181807-100181829 TGATGTCAACCTTGATCACCTGG + Intergenic
960183158 3:114606893-114606915 CGAGGCCAGCCTTGCTAACATGG + Intronic
960377289 3:116918801-116918823 CGAGACCAACCTTGCTAACATGG - Intronic
961833709 3:129639349-129639371 CGAGATCATCCTGGCTCACATGG + Intergenic
962956445 3:140271194-140271216 GGAGGTCACCTCTGCTCACCAGG + Intronic
963945237 3:151138769-151138791 TGATGTTAACCTTGATCACCTGG + Intronic
965852826 3:173051402-173051424 CGAGGTCATCCTGGCTAACACGG - Intronic
970512687 4:16796709-16796731 CGATGTTAAGCTTGATCACCTGG - Intronic
971229398 4:24788087-24788109 CGAGGTCATCCTGGCTAACACGG - Intergenic
971814260 4:31466458-31466480 AGAGGTCATCCCTCCTCACCTGG - Intergenic
972377138 4:38483034-38483056 TGAGGTCATCCTTCCCCACCAGG + Intergenic
972478382 4:39474795-39474817 CGAGGTCATCCTGGCTAACACGG - Intronic
974832082 4:67201898-67201920 CGAGGCCATCCTGGCTAACCTGG - Intergenic
980140271 4:128907346-128907368 GGCTGTCAACATTGCTCACCTGG - Intronic
980797560 4:137704023-137704045 CGAGATCATCCTTGCTAACATGG - Intergenic
981139378 4:141250973-141250995 CGAGATCAACCTGGCTAACACGG + Intergenic
983502141 4:168511872-168511894 CCATGTCACCCCTGCTCACCAGG + Exonic
983916642 4:173299644-173299666 CGAGATCAACCTTGCTAACATGG + Intronic
986410918 5:7478184-7478206 CAAAGACAACCCTGCTCACCTGG - Intronic
986987994 5:13520889-13520911 TGATGTTAACCTTGATCACCTGG + Intergenic
988221008 5:28347417-28347439 CGAGGTCAGCCTGGCTAACCTGG - Intergenic
992559953 5:77941492-77941514 AGATGTTAACCTTGATCACCTGG - Intergenic
994564309 5:101422056-101422078 TGATGTCAACCTTGATCACCTGG + Intergenic
999702138 5:154237842-154237864 CGATGTTGACCTTGATCACCTGG + Intronic
1000180212 5:158802010-158802032 CGAGGTAAACATGGCTCTCCTGG - Intronic
1000411606 5:160938989-160939011 CAAGGTCAGATTTGCTCACCCGG - Intergenic
1004476139 6:15973945-15973967 CCATCTCCACCTTGCTCACCAGG + Intergenic
1004485823 6:16065560-16065582 CGAGACCAACCTGGCTAACCCGG - Intergenic
1005295213 6:24419033-24419055 CGAGGCCATCCTGGCTAACCCGG + Intronic
1005354373 6:24968519-24968541 CTGGGACAACCTTGCTCCCCAGG + Intronic
1011514578 6:88138904-88138926 CGAGGCCAACCTGGCTAACAAGG + Intergenic
1012324637 6:97901062-97901084 CAAGATGAACCTTGCTAACCTGG + Intergenic
1012408470 6:98928528-98928550 CGAGATCAGCCTTGCTAACATGG - Intronic
1012885395 6:104840626-104840648 CGAGATCAGCCTAGCTAACCTGG + Intronic
1013641670 6:112089052-112089074 CGATCTCAACTTGGCTCACCCGG - Intronic
1014930051 6:127325058-127325080 TGATGTTAACCTTGGTCACCTGG - Intronic
1015553258 6:134434393-134434415 TGACGTTAACCTTGATCACCTGG + Intergenic
1015606255 6:134957579-134957601 CGATGTTAACCTTGATCACTTGG + Intergenic
1016347473 6:143129954-143129976 CGATGTCTCCCTTGGTCACCAGG + Intronic
1017456871 6:154608786-154608808 CGATGTTGACCTTGATCACCTGG - Intergenic
1018062248 6:160099567-160099589 CGAGATCAACCTGGCTAACACGG - Intronic
1018401244 6:163422748-163422770 CGGGGCCAACCTTTCTCAGCTGG - Intronic
1018505297 6:164460922-164460944 CGAGACCAACCTGGCTCACACGG - Intergenic
1018819390 6:167361726-167361748 CGAGACCAGCCTTGCTCACATGG - Intronic
1021707969 7:23386760-23386782 TGATGTTAACCTTGATCACCTGG - Intronic
1021803634 7:24333236-24333258 CGAGGTCATCACTTCTCACCTGG - Intergenic
1024018623 7:45344126-45344148 CGACGTTGACCTTGGTCACCTGG - Intergenic
1027590415 7:80112410-80112432 CGAGATCATCCTGGCTCACACGG + Intergenic
1028345557 7:89777882-89777904 TGATGTCAACCTTGTTCACTTGG + Intergenic
1028784013 7:94771783-94771805 TGATGTTAACCTTGATCACCAGG - Intergenic
1029338618 7:99924172-99924194 TGATGTTAACCTTGATCACCCGG + Intronic
1030641201 7:112008791-112008813 CGAGATCAGCCTTGCTAACATGG + Intronic
1034176746 7:149105850-149105872 CGAGGTCATCCTGGCTAACATGG - Intronic
1036007113 8:4678208-4678230 CGAGGTCAGCCTGGCCAACCTGG + Intronic
1036010473 8:4716135-4716157 TGAAGTCAGCCTGGCTCACCAGG - Intronic
1037895338 8:22648609-22648631 TGATGTGAACCTTGATCACCAGG + Intronic
1039540534 8:38364070-38364092 CGAGGTCAGCCTGGCCAACCTGG + Intronic
1040573549 8:48630523-48630545 TGATGTGAACCTTGGTCACCTGG + Intergenic
1040576939 8:48660784-48660806 TGATGTTAACCTTGATCACCTGG + Intergenic
1042623472 8:70731662-70731684 AGAGGTCATCCTTCCCCACCTGG - Intronic
1043288575 8:78567550-78567572 TGATGTCAACCTTGATCACCTGG + Intronic
1043657018 8:82680642-82680664 TGATGTTAACCTTGATCACCTGG + Intergenic
1044195599 8:89373207-89373229 CGAGGTCATCCTGGCTAACATGG - Intergenic
1044874309 8:96649175-96649197 CGAGATCAACCTGGCCCACATGG - Intronic
1045303879 8:100939817-100939839 CGAGACCAACCTGGCTAACCTGG + Intronic
1045836142 8:106523976-106523998 CGAGATCATCCTGGCTAACCTGG - Intronic
1047467356 8:125130296-125130318 TAATGTCAACCTTGATCACCTGG + Intronic
1047956225 8:129978126-129978148 CCAGGTCAATCTTGCACTCCTGG + Intronic
1049956439 9:697309-697331 TGATGTCAACTTTGATCACCTGG + Intronic
1050140039 9:2507958-2507980 TGATGTTAACCTTGATCACCTGG + Intergenic
1050531079 9:6589852-6589874 CGAGGCCATCCTGGCTCACATGG + Intronic
1055021264 9:71672590-71672612 TGATGTTAACCTTGATCACCTGG - Intergenic
1056641782 9:88377689-88377711 CGAGATCAACCTGGCTAACATGG - Intergenic
1056938688 9:90937169-90937191 CCAGGTTTACCTTCCTCACCTGG - Intergenic
1057363574 9:94397860-94397882 TGATGTTAACCTTGATCACCTGG + Intronic
1058114168 9:101066305-101066327 TGATGTTAACCTTGATCACCTGG + Intronic
1058114545 9:101070026-101070048 TGATGTTAACCTTGATCACCTGG + Intronic
1058664540 9:107298529-107298551 CGAGGTCAGCCTGGCTAACATGG - Intronic
1060510952 9:124231840-124231862 CGAGATCAGCCTGGCCCACCTGG + Intergenic
1062700036 9:137894608-137894630 CGAGATCATCCTGGCTCACACGG - Intronic
1191193866 X:57699612-57699634 TGAGGTCAATCTTGATCACCTGG - Intergenic
1193597198 X:83461343-83461365 CGAGATCATCCTTGCTAACACGG + Intergenic
1195035544 X:100968449-100968471 TGATGTTAACCTTGATCACCTGG - Intergenic
1195336062 X:103855814-103855836 TGATGTCAATCTTGATCACCAGG + Intergenic
1195854453 X:109315041-109315063 CGAGGTCAACATCACACACCCGG - Intergenic
1198279640 X:135128994-135129016 TAAGTTCAACCTTGGTCACCTGG - Intergenic
1198291317 X:135243520-135243542 TAAGTTCAACCTTGGTCACCTGG + Intergenic
1199475904 X:148244884-148244906 CGATGTTAACCTTGATGACCTGG - Intergenic